Monitoring F165 ₁ P-Like Fimbria Expression at the Single-Cell Level Reveals a Highly Heterogeneous Phenotype

Abstract

A dherence to host cells relies on the synthesis of specialized molecules that play an important role in multiple steps during the infectious process. Adhesins contribute to virulence by promoting the attachment and bacterial colonization on the host cell surface. Escherichia coli possesses a wide variety of adhesins, which all differ in structure and in functions. Moreover, a single strain can present more than one adhesin. This implies a complex regulatory network to produce exclusively one adhesin or to simultaneously express more than one.Phase variation of P fimbriae is a stochastic and reversible switch between an on phenotype and an off phenotype, "all-ornothing" (ON/OFF), each capable of responding to a specific condition. After cell division, the majority of daughter cells retain the expression phase of the parent; a minority switches to the opposite expression phase. F165 1 fimbriae, encoded by the foo gene cluster, are members of the type P fimbria family of Escherichia coli (1-4). The regulatory region of foo shares more than 96% identity with that of the pyelonephritis-associated pili (pap) gene. Previous work showed that F165 1 fimbriae are essential for virulence and survival during systemic stages of infection in young pigs (5-8). F165 1 fimbriae are principally found in infections caused by opportunistic E. coli in animals, while Pap fimbriae are found in human clinical cases of urinary tract infections. The phase variation of F165 1 fimbriae shares similar features with that of the wellcharacterized Pap fimbriae (9-11). This includes an ϳ400-bp intergenic region surrounded by two divergently transcribed genes (papI and papB for Pap, fooI and fooB for F165 1 ). It also includes six leucine-responsive regulatory protein (Lrp) binding sites, of which two are GATC sites (referred to as GATC prox and GATC dist , respectively), spaced 102 bp apart. In pap and foo, phase variation occurs because of methylation-controlled modifications within the regulatory region of the fimbrial operon. This regulation is epigenetic since it does not involve any changes in DNA sequence (12). The differential methylation status of these sequences determines the binding of Lrp. Indeed, the switch from one phenotype to the other arises from the competition between the binding of Lrp at its distal or proximal binding sites and methylation by the Dam methyltransferase at the opposite GATC site (for reviews, see references 9, 10, and 11). When GATC dist is fully methylated, Lrp cooperatively binds to sites 1 to 3, maintaining the cells in the OFF state; when GATC prox is fully methylated, Lrp binds to sites 4 to 6, maintaining the ON state (Fig. 1). Control of pap expression also requires the action of PapI, a positive regulator that increases the affinity of Lrp for sites 4 to 6 in vivo (11,13). PapB, the second specific regulator of the pap operon, plays an important role by coordinating the expression of the pBA and pI promoters (11). All together, the combined actions of Lrp, Dam methyltransferase, PapI, and PapB result...

Spatially localized expression of glutamate decarboxylasegadBinEscherichia coliO157:H7 microcolonies in hydrogel matrix

“…The E. coli O157:H7 CM454 30,31 is the wild type strain in this study. We used a T7 polymerase (T7pol) amplification technique inspired from previous reports 32,33 , where the cassette T7pol::Cm R is inserted after the genetic sequence of the gene gadB using the Datsenko-Wanner 34 recombination technique (supplementary material Figure S1). Regions of identity were added at the ends of the cassette by the forward primer: 5’CCGAAACTGCAGGGTATTGCCCAACAGAACAGCTTTAAACATACCTGATAACA GGAGGTAAATAATGCACACGATTAACATCGC3’ and reverse primer: 5’AAATTGTCCCGAAACGGGTTCGTTTCGGACACCGTTACCGTTAAACATGGAGTT CTGAGGTCATTACTG3’.…”

“…The correct insertion of T7pol::Cm R in the construct was verified by PCR using the forward primer 5’GGAAGACTACAAAGCCTCCC3’ and reverse primer 5’ TATTCCTGTCGGAACCGCAC3’, for sequencing (Eurofins Genomics, Germany). Based on the sequence of the pHL40 plasmid 32 , a new plasmid was synthetized (GeneArt, ThermoFisher Scientific, Germany) bearing the P T7pol ::GFPmut3:: T p7pol as a GFP reporter but modified by insertion of P BBa_J23119 ::mCherry2:: T BBa_B0062 (iGEM parts) for constitutive expression of a red fluorescent protein (RFP). This new plasmid, called pHL60, was transformed into competent gadB::T7pol::Cm R bacterial cells.…”

Spatially localised expression of the glutamate decarboxylase gadB in Escherichia coli O157:H7 microcolonies in hydrogel matrices

“…To monitor the gene expression, we genetically engineered a dual fluorescent reporter system inspired from genetic amplification systems based on T7 polymerase ( T7pol ) 55 , 56 , where a T7pol::Cm R cassette is inserted afterward the gene of interest (Supplementary Fig. 1 ).…”

“…The correct insertion of T7pol::Cm R in the construct was verified by PCR using the forward primer 5’-GGAAGACTACAAAGCCTCCC-3’ and reverse primer 5’-TATTCCTGTCGGAACCGCAC-3’, for sequencing (Eurofins Genomics, Germany) (Supplementary Table 1 ). Based on the sequence of the pHL40 plasmid 55 , a new plasmid was synthetised (GeneArt, ThermoFisher Scientific, Germany) bearing the P T7pol ::GFPmut3:: T T7pol as a green fluorescent protein (GFP) reporter but modified by insertion of P BBa_J23119 ::mCherry2:: T BBa_B0062 (iGEM parts) for constitutive expression of the red fluorescent protein (RFP) mCherry2. This new plasmid, called pHL60, was transformed into competent gadB::T7pol::Cm R bacterial cells.…”