Monitoring of the bacterial and fungal biodiversity and dynamics during Massa Medicata Fermentata fermentation

Abstract

The microbial community dynamics play an important role during Massa Medicata Fermentata (MMF) fermentation. In this study, bacterial and fungal communities were investigated based on the culture-dependent method and polymerase chain reaction-denaturing gradient gel electrophoresis analysis. Meanwhile the dynamic changes of digestive enzyme activities were also examined. Plating results showed that MMF fermentation comprised two stages: pre-fermentation stage (0–4 days) was dominated by bacterial community and post-fermentation stage (5–9 days) was dominated by fungal community. The amount of bacteria reached the highest copy number 1.2 × 1010 CFU/g at day 2, but the fungi counts reached 6.3 × 105 CFU/g at day 9. A total of 170 isolates were closely related to genera Enterobacter, Klebsiella, Acinetobacter, Pseudomonas, Mucor, Saccharomyces, Rhodotorula, and Amylomyces. DGGE analysis showed a clear reduction of bacterial and fungal diversity during fermentation, and the dominant microbes belonged to genera Enterobacter, Pediococcus, Pseudomonas, Mucor, and Saccharomyces. Digestive enzyme assay showed filter paper activity; the activities of amylase, carboxymethyl cellulase, and lipase reached a peak at day 4; and the protease activity constantly increased until the end of the fermentation. In this study, we carried out a detailed and comprehensive analysis of microbial communities as well as four digestive enzymes' activities during MMF fermentation process. The monitoring of bacterial and fungal biodiversity and dynamics during MMF fermentation has significant potential for controlling the fermentation process.

Analysis of microbial diversity in Shenqu with different fermentation times by PCR-DGGE

“…This study confirmed that pathogenic bacteria exist in the traditional Chinese medicine Shenqu. The existence of pathogenic bacteria is likely to affect the quality of various batches of Shenqu compared with batches of Shenqu that have undergone pure bred fermentation22, 6 also investigated the microbial community of Shenqu by PCR-DGGE and found that the dominant microbes belonged to the genera Enterobacter , Pediococcus, Pseudomonas , Mucor , and Saccharomyces , which are results that are somewhat different from ours. This outcome is probably due to the different proportions of ingredients and fermentation parameters used in the two studies.…”

The effect of lactic acid bacterial starter culture and chemical additives on wilted rice straw silage

“…For fungi, the approximate 350 bp fragment of the 18S rRNA gene was amplified using the primers NS1 (GTAGTCATATGCTTGTCTC) and GC‐Fung (CGCCCGCCGCGCCCCGCGCCCGGCCCGCCGCCCCCGCCCCATTCCCCGTTACCCGTTG) (Xu et al . ).…”

Application of Serratia marcescensRZ‐21 significantly enhances peanut yield and remediates continuously cropped peanut soil

“…Total contents of soil bacteria and fungi were determined by real‐time PCR amplifications as described above. The bacteria‐specific primer set was 357f (5′‐CCTACGGGAGGCAGCAG‐3′)/517r (5′‐ATTACCGCGGCTGCTGG‐3′) and the fungi‐specific primer set was NS1 (5′‐GTAGTCATATGCTTGTCTC‐3′)/GCFung (5′‐ATTCCCCGTTACCCGTTG‐3′) …”

“…The bacteria-specific primer set was 357f (5 ′ -CCTACGGGA GGCAGCAG-3 ′ )/517r (5 ′ -ATTACCGCGGCTGCTGG-3 ′ ) 24 and the fungi-specific primer set was NS1 (5 ′ -GTAGTCATATGCTTGTCTC-3 ′ )/ GCFung (5 ′ -ATTCCCCGTTACCCGTTG-3 ′ ). 25…”