MouseV k gene classification by nucleic acid sequence similarity

Strohal, Robert; Helmberg, Arno; Kroemer, Guido; Kofler, Reinhard

doi:10.1007/bf02421180

Cited by 96 publications

(43 citation statements)

References 86 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…2 a-c. (a-c). In all three Daisy line mice analyzed, V 1 family member number 82 (marked with an asterisk) was more prevalent in the mature B cell population than the immature B cell population, and this enhancement was significant (P Ͻ 0.003) (15). of development and would therefore not affect the subsequent repertoire shift noted here.…”

Section: Discussionmentioning

confidence: 62%

See 1 more Smart Citation

A B-cell receptor-specific selection step governs immature to mature B cell differentiation

Levine

Haberman

Sant’Angelo

et al. 2000

Proc. Natl. Acad. Sci. U.S.A.

143

115

View full text Add to dashboard Cite

(3,4). Before these immature cells leave the bone marrow for the periphery, it has been shown, they undergo several types of negative selection to avoid autoreactivity. These processes, including clonal deletion (5), receptor editing (6, 7), and clonal anergy (8), are thought to be largely complete before the exit of these cells into the periphery, where a fraction of them subsequently differentiate into mature B cells (Hardy fraction F) (9, 10), which are surface IgM int , IgD hi , B220 hi , HSA int (4). Seventy percent of peripheral immature B cells that bear functional surface IgM (fraction E) do not survive to maturity (fraction F), although the nature of the process that causes this cell loss is unknown (3). This cell loss either could occur by a stochastic process in which cell fate is determined without regard to the specificity of the BCR or could occur by a selective process in which the specificity of the BCR determines which cells can survive.To better understand the selective processes that determine which immature B cells survive to comprise the mature BCR repertoire, we examined the BCR repertoire of immature peripheral B cells and compared it to the BCR repertoire of mature peripheral B cells. A stochastic process would predict identical BCR repertoires in the immature and mature B cell populations; a selective process would be reflected by substantial differences between the two repertoires. We find that there is indeed significant selection of the BCR repertoire at the immature to mature conventional B cell transition in the periphery of the mouse. The nature of this selection is most indicative of positive selection of certain cells that comprise a small fraction of the BCR repertoire. Materials and MethodsMice. Heavy chain transgenic mice of Meg and Daisy line were constructed as described (11) -biotin antibody (PharMingen). All biotinylated antibodies were revealed with streptavidin-Texas Red. Additional staining with anti-B7.2-biotin (clone GL1) (12), rat anti-mouse-CD1d purified antibody (PharMingen) followed by a goat anti-rat-IgG-biotin secondary (Kirkegaard & Perry Laboratories), anti-CD5 (clone 53.7), and anti-CD44 (clone PgP-1) (11) was performed to assess surface expression of these markers. PCR Amplification. Genomic DNA was extracted with the DNAzol reagent (GIBCO͞BRL) and was amplified by using a degenerate V consensus primer (13) and one of two J 2 intronic primers. The internal J 2 primer (14) was utilized for the first Meg line mouse and all three Daisy line mice analyzed. An external J 2 primer, TCCCTCCTTAACACCTGATCTGAGAATGG, was used for the analysis of the second two Meg line mice and the wild-type control mouse. PCR conditions were 28 cycles of 94°C for 30 sec, 60°C for 90 sec, and 72°C for 60 sec, with a 5-sec extension per cycle (14).Cloning and Sequencing. Consensus V -J 2 PCR products (Ϸ190 bp for the internal J 2 primer and Ϸ300 bp for the external J 2 Abbreviation: BCR, B cell receptor.

show abstract

Section: Discussionmentioning

confidence: 62%

“…Sequences were analyzed with MACVECTOR software (Oxford Molecular Group, Oxford, U.K.). A database of light chains by the method of Strohal et al was generated in MACVECTOR to assign individual sequences to specific V members (15). Sequences with 1-bp mismatches were considered to be attributable to Taq substitution error as described (14).…”

Section: Methodsmentioning

confidence: 99%

A B-cell receptor-specific selection step governs immature to mature B cell differentiation

Levine

Haberman

Sant’Angelo

et al. 2000

Proc. Natl. Acad. Sci. U.S.A.

143

115

View full text Add to dashboard Cite

show abstract

“…All three murine V gene fragments belonged to the V1 gene family but showed the highest sequence homology to different germ line genes (17,46,59). Both 207,B-4 and 208,D-5 shared high homology (98.6 and 97.6%, respectively) to K1A5, whereas the V gene of MN14C11.6 showed 99% homology to the germ line gene K5.1.…”

Section: Resultsmentioning

confidence: 99%

Functional Activities and Immunoglobulin Variable Regions of Human and Murine Monoclonal Antibodies Specific for the P1.7 PorA Protein Loop ofNeisseria meningitidis

Wang¹,

Jarvis

Achtman

et al. 2000

Infect Immun

View full text Add to dashboard Cite

The meningococcal PorA protein is considered a promising vaccine candidate. Although much is understood regarding the structure of PorA proteins, little is known about the structure-function relationships of PorA antibodies. The aim of this study was to compare the functional and molecular characteristics of a human monoclonal antibody (MAb) and three murine MAbs specific for the PorA P1.7 serosubtype. Murine MAbs 207,B-4 (immunoglobulin G2a [IgG2a]) and MN14C11.6 (IgG2a) were both bactericidal and opsonophagocytic for P1.7-expressing meningococci, whereas human MAb SS269 (IgG3) and murine MAb 208,D-5 (IgA) initiated neither effector function. Epitope mapping with synthetic peptides revealed that MAbs 207,B-4 and 208,D-5 recognized the sequence ASGQ, which is the same specificity motif that a previous study had established for SS269 and MN14C11.6. Nucleotide and amino acid sequence analyses of the variable regions of the four MAbs showed that the SS269 V H region belonged to the VH3 family and was approximately 70% homologous to those of the murine MAbs which were all from the 7183 family, whereas the SS269 V L region belonged to the V1-b family and was less than 40% homologous to those of the murine MAbs which were all members of the V1 family. The Fab fragment of SS269 was cloned and expressed in Escherichia coli and was shown by enzymelinked immunosorbent assay analyses to bind as well as intact SS269 MAb to P1.7,16 serosubtype group B strain 44/76. We conclude that distinct differences exist in the effector function activities and variable region gene sequences of human and murine P1.7-specific MAbs despite their recognition of similar epitopes.Disseminated meningococcal infection is a fulminant disease with high morbidity and mortality (3). Immune defense against this illness depends on recognition of the bacterial surface by antibody and activation of complement (32). The current meningococcal vaccine is composed of the meningococcal capsular polysaccharides of serogroups A, C, Y, and W135 (7). Although the efficacy of the vaccine in adults and older children is quite high, the response is age dependent in younger children, and children younger than 2 years of age respond poorly (13,25,41). In addition, the vaccine does not include the serogroup B capsular polysaccharide, as it is poorly immunogenic (68), and therefore vaccination does not protect against disease due to serogroup B strains that are responsible for the majority of meningococcal infections in many countries (58). Thus, the development of a vaccine for protection against serogroup B infection has focused on outer membrane proteins as alternative targets (50).The PorA class 1 outer membrane protein is a major outer membrane porin protein expressed by almost all meningococcal strains (23,64,65). Sequence comparisons of PorA proteins have shown strong homology among the proteins with the major variation confined to two discrete regions termed variable region 1 (VR1) and VR2 (42,62). Based on a two-dimensional topology model, PorA has eight predi...

show abstract

“…A, The total number of hybridomas and of T3 HA-specific and PR8 HA-specific hybridomas generated from BALB/c (n ϭ 3) and HACII (n ϭ 3) splenocytes 5 days after primary immunization with T3 virus. B, V H and V gene families, as well as the JH and J gene segments used by PR8 HA-specific hybridomas generated from individual HACII mice (3511, 3513, and 756) were determined by nucleotide sequences assigned to previously described families (57,58). C12 B cells were identified by the use of the prototypic VC12/ VHC12 gene segment combination.…”

Section: Figurementioning

confidence: 99%

Specificity-Based Negative Selection of Autoreactive B Cells during Memory Formation

Guay

Panarey

Reed

et al. 2004

The Journal of Immunology

View full text Add to dashboard Cite

Autoreactive B cells are not completely purged from the primary B cell repertoire, and whether they can be prevented from maturation into memory B cells has been uncertain. We show here that a population of B cells that dominates primary immune responses of BALB/c mice to influenza virus A/PR/8/34 hemagglutinin (HA) are negatively selected in transgenic mice expressing PR8 HA as an abundant membrane-bound Ag (HACII mice). However, a separate population of B cells that contains precursors of memory B cells is activated by PR8 virus immunization and is subsequently negatively selected during the formation of the memory response. Negative selection of PR8 HA-specific B cells altered the specificity of the memory B cell response to a mutant virus containing a single amino acid substitution in a B cell epitope. Strikingly, this skewed reactivity resulted from an increase in the formation of memory B cells directed to non-self-epitopes on the mutant virus, which increased 8-fold in HACII mice relative to nontransgenic mice and precisely compensated for the absence of autoreactive PR8 HA-specific memory B cells. Negative selection of PR8 HA-specific B cells was a dominant process, since B cells from HACII mice could induce negative selection of PR8 HA-specific B cells from BALB/c mice. Lastly, HA-specific memory responses were unaffected by self-tolerance in another lineage of HA-transgenic mice (HA104 mice), indicating that the amount and/or cell type in which self-Ags are expressed can determine their ability to prevent autoreactive memory B cell formation.

show abstract

MouseV k gene classification by nucleic acid sequence similarity

Cited by 96 publications

References 86 publications

A B-cell receptor-specific selection step governs immature to mature B cell differentiation

A B-cell receptor-specific selection step governs immature to mature B cell differentiation

Functional Activities and Immunoglobulin Variable Regions of Human and Murine Monoclonal Antibodies Specific for the P1.7 PorA Protein Loop ofNeisseria meningitidis

Specificity-Based Negative Selection of Autoreactive B Cells during Memory Formation

Contact Info

Product

Resources

About