Multilocus sequence typing (MLST) and M13 PCR fingerprinting revealed heterogeneity amongstCryptococcusspecies obtained from Italian veterinary isolates

Danesi, Patrizia; Firacative, Carolina; Cogliati, Massimo; Otranto, Domenico; Capelli, Gioia; Meyer, Wieland

doi:10.1111/1567-1364.12178

Cited by 33 publications

(26 citation statements)

References 76 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…The data of strains WM629, CBS7816, PD32, PD2270, PD1596, RKI 08-0429, RKI 04-0089, RKI 09-0388, RKI 09-0515, RKI 07-0173, RKI 05-0151, RKI 04-0061, RKI 09-0393, RKI 09-0545, RKI 09-0102, RKI 09-0103, RKI 11-0048, RKI 08-0591, RKI 08-0572, RKI 11-0047) were obtained from previous studies (Sanchini et al, 2014; Kaocharoen et al, 2013; Meyer et al, 2009; Danesi et al, 2014). …”

Section: Methodsmentioning

confidence: 99%

Multilocus sequence typing analysis reveals that Cryptococcus neoformans var. neoformans is a recombinant population

Cogliati

Zani

Rickerts

et al. 2016

Fungal Genetics and Biology

Self Cite

View full text Add to dashboard Cite

Cryptococcus neoformans var. neoformans (serotype D) represents about 30% of the clinical isolates in Europe and is present less frequently in the other continents. It is the prevalent etiological agent in primary cutaneous cryptococcosis as well as in cryptococcal skin lesions of disseminated cryptococcosis. Very little is known about the genotypic diversity of this Cryptococcus subtype. The aim of this study was to investigate the genotypic diversity among a set of clinical and environmental C. neoformans var. neoformans isolates and to evaluate the relationship between genotypes, geographical origin and clinical manifestations. A total of 83 globally collected C. neoformans var. neoformans isolates from Italy, Germany, France, Belgium, Denmark, Greece, Turkey, Thailand, Japan, Colombia, and the USA, recovered from different sources (primary and secondary cutaneous cryptococcosis, disseminated cryptococcosis, the environment, and animals), were included in the study. All isolates were confirmed to belong to genotype VNIV by molecular typing and they were further investigated by MLST analysis. Maximum likelihood phylogenetic as well as network analysis strongly suggested the existence of a recombinant rather than a clonal population structure. Geographical origin and source of isolation were not correlated with a specific MLST genotype. The comparison with a set of outgroup C. neoformans var. grubii isolates provided clear evidence that the two varieties have different population structures.

show abstract

Section: Methodsmentioning

confidence: 99%

Multilocus sequence typing analysis reveals that Cryptococcus neoformans var. neoformans is a recombinant population

Cogliati

Zani

Rickerts

et al. 2016

Fungal Genetics and Biology

Self Cite

View full text Add to dashboard Cite

show abstract

“…DNA was extracted with the phenol–chloroform–isoamyl alcohol (25:24:1, v:v:v) method [10]. The URA5 gene was amplified with the following primers URA5 () and SJ01 ().…”

Section: Methodsmentioning

confidence: 99%

Molecular epidemiology of cryptococcal genotype VNIc/ST5 in Siriraj Hospital, Thailand

et al. 2017

View full text Add to dashboard Cite

Despite the strong association between Cryptococcus neoformans infection and the Human immunodeficiency virus (HIV) status of patients globally, most cryptococcosis cases in Far East Asia occur in non-HIV individuals. Molecular epidemiological studies, using multilocus sequence typing (MLST), have shown that more than 95% of cryptococcal strains belong to a specific subtype of VNI. However, this association has never been specifically examined in other parts of Asia. Therefore, in this study, we investigated the VNIc/ST5 genotype distribution among cryptococcosis patients in Thailand. Fifty-one C. neoformans isolates were collected from clinical samples in Siriraj Hospital, Bangkok, Thailand. The strains were predominantly isolated from HIV-positive patients (88.57%) and all were molecular type VNI MATα. An MLST analysis identified five sequence types (ST) in Siriraj Hospital, of which ST4 (45.10%) and ST6 (35.29%) were most common, and ST5 (15.69%), ST32 (1.96%), and ST93 (1.96) were less common. Contrary to reports from Far East Asia, ST5 was predominantly (83.33%) found in HIV patients (P = 0.657), and there was no significant change in the prevalence of ST5 over the past 10 years (P = 0.548). A further analysis of comorbidities showed higher morbidity and delays in the cryptococcal diagnosis in patients with tuberculosis coinfection or without HIV. Our study suggests that although the Thai population is genetically closely related to the Far East Asian population, ST5 is not associated with non-HIV status in Thailand. Therefore, this association may not be related to the host’s genetic background. However, its mechanism remains unclear.

show abstract

“…DNA was extracted using the phenol-chloroform-isoamyl alcohol (25:24:1, v: v: v) method. 19 The URA5 gene was amplified with the following primers, URA5 (5ʹATGTCCTCCCAAGCCCTCGACTCCG3ʹ) and SJ01 (5ʹTTAAGACC TCTGAACACCGTACTC3ʹ). Genotypes were determined with a restriction fragment length polymorphism analysis (RFLP) of the URA5 gene digested with restriction enzymes HhaI and Sau96I (Thermo Fisher Scientific, MA, USA).…”

Section: Analysis Of Genotypementioning

confidence: 99%

“…Therefore, an alternative value, an epidemiological cutoff value (ECVs), while not predictive of in vivo efficacy, has been offered by experts to determine whether a strain is wild type (in vitro susceptible) or non-wild type (in vitro resistant). 18,19 This number is selected by a committee, such as the Clinical and Laboratory Standards Institute (CLSI), based on pharmacologic consideration and not clinical outcome. For example, the availability of reference methodologies has enabled the recognition of resistant isolates as well as proposed CBPs and ECVs for Candida spp.…”

Section: Introductionmentioning

confidence: 99%

Cryptococcus neoformans/gattii Species Complexes from Pre-HIV Pandemic Era Contain Unusually High Rate of Non-Wild-Type Isolates for Amphotericin B

Pharkjaksu

Chongtrakool

Chayakulkeeree

et al. 2020

IDR

View full text Add to dashboard Cite

Introduction: The Cryptococcus neoformans/gattii species complexes are a leading cause of fatality among HIV-infected patients. Despite the unavailability of clinical breakpoints (CBPs) for antifungal agents, epidemiological cutoff values (ECVs) were recently proposed, and non-wild-type isolates for polyenes and azoles are being increasingly reported. However, the distributions of the susceptibility patterns for pre-HIV-era isolates have not been studied. Methods: We determined the in vitro antifungal susceptibility patterns of 233 Cryptococcus isolates, collected at the National Institutes of Health, USA, in pre-HIV pandemic era, to study minimum inhibitory concentrations (MICs) to the important drugs for cryptococcosis and to compare the results with strain genotypes. Amphotericin B susceptibility was compared to published ECV of C. neoformans. Results: The 233 Cryptococcus strains consisted of 89.7% C. neoformans species complex and 10.3% C. gattii species complex. Most were from clinical sources (189, 81.1%), and the major molecular type was VNI (146, 62.7%). The highest geometric mean (GM) was observed for fluconazole (GM = 0.96 µg/mL) while the lowest was for itraconazole (GM = 0.10 µg/mL). MICs to fluconazole in C. gattii species complex were significantly higher than C. neoformans species complex (p < 0.001). Moreover, C. neoformans/VNI strains showed significantly higher MICs than others such as C. neoformans/VNII to fluconazole (p < 0.0001) and C. deneoformans/VNIV to amphotericin B (p = 0.022) and fluconazole (p = 0.008). In our collection of 167 clinical C. neoformans species complex strains, 85 (50.9%), 24 (14.4%), and 3 (1.8%) strains had an amphotericin B (AMB)-MIC of 1, 2, and 4 µg/mL, respectively. The high percentage (66.9%, 79/118 strains) of non-wild-type clinical C. neoformans VNI strains, using an AMB-ECV of 0.5 µg/mL, was found. Moreover, 25 of 28 (89.3%) C. neoformans VNI strains from environmental and veterinary sources also had AMB-MICs above 0.5 µg/mL. In general, there was no significant difference in GM AMB-MIC of the clinical strains isolated from patients with (35 patients) and without (78 patients) prior AMB treatment (0.85 vs 0.76; p = 0.624). GM MIC of the environmental strains was not significantly different from that of the prior AMB-treatment strains (0.98 vs 0.76, p = 0.159) and the post-AMB-treatment strains (0.98 vs 0.85, p = 0.488). Conclusion: The high rate of non-wild-type among these otherwise naive isolates to amphotericin B is unexpected. Confirmation with more strains from a later era is needed.

show abstract

Multilocus sequence typing (MLST) and M13 PCR fingerprinting revealed heterogeneity amongstCryptococcusspecies obtained from Italian veterinary isolates

Cited by 33 publications

References 76 publications

Multilocus sequence typing analysis reveals that Cryptococcus neoformans var. neoformans is a recombinant population

Multilocus sequence typing analysis reveals that Cryptococcus neoformans var. neoformans is a recombinant population

Molecular epidemiology of cryptococcal genotype VNIc/ST5 in Siriraj Hospital, Thailand

<p><em>Cryptococcus neoformans/gattii</em> Species Complexes from Pre-HIV Pandemic Era Contain Unusually High Rate of Non-Wild-Type Isolates for Amphotericin B</p>

Contact Info

Product

Resources

About