Multilocus sequence typing of Giardia duodenalis genotypes circulating in humans in a major metropolitan area

Abstract

Giardia duodenalis is an intestinal protozoan parasite of humans and animal hosts and comprises eight microscopically indistinguishable molecularly-diverse lineages designated as assemblages A–H. Assemblages A and B are the primary sources of infections in humans and a wide range of mammals. Here, we identified assemblages, and inter-/intra-assemblage genetic diversity of human G. duodenalis isolates based on the multilocus sequence typing of the triosephosphate isomerase (tpi), β -giardin (bg), and glutamate dehydrogenase (gdh) loci. Multilocus sequence analysis of 62 microscopically-positive G. duodenalis fecal samples identified 26 (41.9%), 27 (43.5%), and nine (14.5%) isolates belonging to assemblages A, B, and discordant assemblages, respectively. The tpi locus assemblage-specific primers identified dual infections with A and B assemblages (45.2%). The sequence analysis of multiple alignments and phylogenetic analysis showed low genetic polymorphism in assemblage A isolates, classified as sub-assemblage AII at three loci, subtype A2 at tpi and gdh loci, and subtype A2 or A3 at bg locus. High genetic variations were found in assemblage B isolates with 14, 15, and 23 nucleotide patterns at tpi, bg, and gdh loci, respectively. Further concatenated sequence analysis revealed four multilocus genotypes (MLG) in 24 assemblages A isolates, two previously-identified (AII-1 and AII-5), with one novel multilocus genotype. However, the high genetic variations observed in assemblage B isolates among and within the three genetic loci prevented the definitive designation of specific MLGs for these isolates. Multilocus sequence typing may provide new insight into the genetic diversity of G. duodenalis isolates in Tehran, suggesting that humans are likely a potential source of G. duodenalis infection. Further host-specific experimental transmission studies are warranted to elucidate the modes of transmission within multiple host populations.

Molecular identification of Cryptosporidium, Giardia, and Blastocystis from stray and household cats and cat owners in Tehran, Iran

“…Cat owners reported no particular clinical symptoms at the sampling time in themselves or their cats. First, the sucrose flotation procedure was performed on 33 human fecal samples for concentrating oocysts/cysts of Cryptosporidium / Giardia 17 , 18 . Then, the DNA of samples was extracted using the QIAamp DNA Mini Kit following the manufacturer’s instructions.…”

“… Cycling conditions Refs. Cryptosporidium SSU rRNA F: ACCTATCAGCTTTAGACGGTAGGGTAT R: TTCTCATAAGGTGCTGAAGGAGTAAGG F: ACAGGGAGGTAGTGACAAGAAATAACA R: AAGGAGTAAGGAACAACCTCCA 611 19 PCR 1: 45 s/94 °C, 45 s/56 °C, 45 s/72 °C, 39 cycles PCR2: 45 s/94 °C, 45 s/58 °C, 30 s/70 °C, 35 cycles This study G. duodenalis bg F: AAGCCCGACGACCTCACCCGCAGTGC R: GAGGCCGCCCTGGATCTTCGAGACGAC F: GAACGAACGAGATCGAGGTCCG R: CTCGACGAGCTTCGTGTT 511 20 PCR 1: 30 s/95 °C, 30 s/65 °C, 60 s/72 °C, 35 cycles PCR 2: 30 s/95 °C, 30 s/55 °C, 60 s/72 °C, 35 cycles 23 G. duodenalis gdh F: TCAACGTYAAYCGYGGYTTCCGT R: GTTRTCCTTGCACATCTCC F: CAGTACAACTCYGCTCTCGG R: GTTRTCCTTGCACATCTCC 430 21 PCR 1: 2 min/94 °C, 60 s/61 °C, 2 min/68 °C, 1 cycle; 30 s/94 °C, 20 s/61 °C, 20 s/68 °C, 30 cycles PCR 2: 2 min/94 °C, 60 s/60 °C, 2 min/65 °C, 1 cycle; 30 s/94 °C, 20 s/60 °C, 20 s/65 °C, 15 cycles 18 G. duodenalis tpi F: AAATIATGCCTGCTCGTCG R: CAAACCTTITCCGCAAACC F: CCCTTCATCGGIGGTAACTT R: GTGGCCACCACICCCGTGCC 530 22 PCR 1: 45 s/94 °C, 45 s/50 °C, 60 s/72 °C, 35 cycles PCR 2: 45 s/94 °C, 45 s/58 °C, 60 s/72 °C, 35 cycles 23 Blastocystis SSU rRNA F: GGAGGTAGTGACAATAAATC R: TAAGACTACGAGGGTATCTA 550–585 24 60 s/94 °C, 45 s/56 °C, 45 s/72 °C, 35 cycles 24 ...…”

“…Molecular identification and multilocus genotyping of G. duodenalis were performed by amplification of the ß-giardin ( bg ), glutamate dehydrogenase ( gdh ), and triosephosphate isomerase ( tpi ) genes to assess the DNA of G. duodenalis in the fecal samples of cats and cat owners. For this purpose, a 511-bp fragment of the bg gene 20 , a 432-bp fragment of the gdh gene 21 , and a 530-bp fragment of the tpi gene 22 were amplified by a nested PCR, a semi-nested PCR, and a nested PCR, respectively, according to previous procedures 18 , 23 (Table 1 ). The assemblages, sub-assemblages, and genotypes of G. duodenalis isolates were identified by sequencing each marker's internal amplified fragments.…”

Molecular epidemiology and multilocus genotyping of Giardia duodenalis in individuals attending major public hospitals in Shiraz, southwestern Iran: A public health concern

“…Giardia lamblia , Giardia intestinalis ) is a parasite that infects the small intestine of mammals, including humans. G. duodenalis is a globally distributed parasitic protozoan with a prevalence of 0.4–7.5% in developed countries and 8–30% in developing countries ( Hashemi-Hafshejani et al, 2022 ; Heyworth, 2016 ). G. duodenalis infections are caused by ingesting cysts in contaminated food or water.…”

“…Following nucleotide sequence and phylogenetic analysis have confirmed sub-assemblages AI–AIII within assemblages A, with AI being isolated mostly from animals, whereas AII is primarily determined in humans. Additionally, AIII has mainly been reported in wild mammals (e.g., deer), with only two human cases reported recently ( Hashemi-Hafshejani et al, 2022 ; Seabolt et al, 2022 ). Moreover, multilocus sequence typing (MLST) has distinguished 9–12 subtypes/genotypes at each of the individual loci within the three main sub-assemblages A.…”