Multimerization of Tegument Protein pp28 within the Assembly Compartment Is Required for Cytoplasmic Envelopment of Human Cytomegalovirus

Abstract

Human cytomegalovirus (HCMV) UL99-encoded pp28 is an essential tegument protein required for envelopment and production of infectious virus. Nonenveloped virions accumulate in the cytoplasm of cells infected with recombinant viruses with the UL99 gene deleted. Previous results have suggested that a key function of pp28 in the envelopment of infectious HCMV is expressed after the protein localizes in the assembly compartment (AC). In this study, we investigated the potential role of pp28 multimerization in the envelopment of the infectious virion. Our results indicated that pp28 multimerized during viral infection and that interacting domains responsible for self-interaction were localized in the amino terminus of the protein (amino acids [aa] 1 to 43). The results from transient-expression and/or infection assays indicated that the self-interaction took place in the AC. A mutant pp28 molecule containing only the first 35 aa failed to accumulate in the AC, did not interact with pp28 in the AC, and could not support virus replication. In contrast, the first 50 aa of pp28 was sufficient for the self-interaction within the AC and the assembly of infectious virus. Recombinant viruses encoding an in-frame deletion of aa 26 to 33 of pp28 were replication competent, whereas infectious virus was not recovered from HCMV BACs lacking aa 26 to 43. These findings suggested that the accumulation of pp28 was a prerequisite for multimerization of pp28 within the AC and that pp28 multimerization in the AC represented an essential step in the envelopment and production of infectious virions.Human cytomegalovirus (HCMV) is an important human pathogen associated with acute and chronic disease in both normal and immunocompromised populations (4,34,45,46). The virus is the largest and most complex member of the family of human herpesviruses. The virion of HCMV consists of three distinct structures: a nucleocapsid containing a 230-kbp linear DNA genome that may encode over 200 open reading frames (ORFs), an envelope including an as-yet-undefined number of viral glycoproteins, and a tegument layer located between the capsid and envelope (31,32,49,53,55). In addition, the virion contains a minimum of 71 virus-encoded proteins and a large number of host-derived proteins (50).HCMV assembly is a multistage, poorly understood process. Although all proposed models include well-studied mechanisms of capsid assembly within the nucleus of infected cells, the final tegumentation and envelopment in the cytoplasm of infected cells remains poorly understood (29). Early ultrastructural studies of herpes simplex virus (HSV) and HCMV noted that nonenveloped cytoplasmic particles in HCMV-infected cells were coated with a thick tegument layer but that nonenveloped HSV particles often had the appearance of naked capsids (44). These and other findings suggested that, in contrast to the assembly of HSV and other alphaherpesviruses, tegument proteins could play a key role in the cytoplasmic phase of HCMV assembly and that the cytoplasmic assembly of HSV and...

Human cytomegalovirus pUL37x1-induced calcium flux activates PKCα, inducing altered cell shape and accumulation of cytoplasmic vesicles

“…EEA1 and pUL99 also localized at the periphery of large vesicles. Similar vesicles have been described previously (7,39). EEA1 binds to the head group of phosphatidylinositol-3-phosphate (PtdIns3P) (35,40), and pUL99 associates with membranes through its myristoyl modification (41), so it is likely that the two proteins associate with the large vesicles at their membranes.…”

“…6 A and B). The vesicles, which have been reported previously (7,39), ranged in diameter from approximately 0.5 μM to nearly 5 μM. They appeared late during the infection cycle, and the EEA1 early endosome marker and pUL99 virion protein localized at their periphery.…”

The Human Cytomegalovirus (HCMV) Tegument Protein UL94 Is Essential for Secondary Envelopment of HCMV Virions

“…Many viral tegument proteins function in assembly by directing proper tegumentation, capsid trafficking, and envelope acquisition at the assembly complex in the cytoplasm (1,20,23,24,26,28,29). We therefore sought to characterize the phenotype of the assembly complex with respect to the localization of viral proteins in cells infected with the UL94stop mutant.…”

Bicaudal D1-Dependent Trafficking of Human Cytomegalovirus Tegument Protein pp150 in Virus-Infected Cells

“…HEK 293 cells (Grip Tite cells; Invitrogen, Carlsbad, CA) were cultured in DMEM supplemented with 10% FCS, 0.1% nonessential amino acids, and 50 g/ml G-418. HCMV proteins were detected with monoclonal antibodies (MAbs) that have been previously described (48,(67)(68)(69)74). MAbs used in the present study include those specific for pp150 , pp28 (MAb 41-18), gM/gN (MAb 14-16A), IE1 (MAb P63-27), and gM (MAb IMP).…”

“…To generate a GFP-mCherry fusion protein for use as a positive control in fluorescence resonance energy transfer (FRET) experiments, the GFP ORF was PCR amplified from pEGFPN1 vector (Clontech) and cloned into pmCherryN1 vector (Clontech) (forward primer, 5ЈGTGTAAGCTTCGCCACCATGGTGAGCAAGGGCGAG3Ј; reverse primer, 5ЈGTGTGGATCCGCCTTGTACAGCTCGTCCATGCCGAG3Ј). The pp28GFP plasmid has been described previously (74) and was subcloned into pmCherryN1 vector (Clontech). The myc-tagged pp28 plasmid has been described previously (75).…”