Multiple Effects of the M184V Resistance Mutation in the Reverse Transcriptase of Human Immunodeficiency Virus Type 1

Turner, Dan; Brenner, Bluma G.; Wainberg, Mark A.

doi:10.1128/cdli.10.6.979-981.2003

Cited by 33 publications

(31 citation statements)

References 35 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The M184I/V mutations are also associated with decreased dNTP usage and have a strong negative impact on viral replication fitness (5,6,14,15,18,24,50). Under selection pressure with 3TC or FTC, both in vitro and in vivo, the M184I mutation usually emerges first and is rapidly replaced by the M184V mutation due to the relative fitness advantage of the latter over the former mutation (13,15,29,48). However, M184I/V mutations are rarely found in cases of transmitted drug resistance (TDR), although the M184V mutation can be detected in newly infected individuals with detection methods that are more sensitive than standard genotyping (12,47,52).…”

Section: Discussionmentioning

confidence: 99%

“…The E138K mutation compensates for M184I/V-mediated deficits in dNTP usage and restores enzyme processivity at low dNTP concentrations, thereby restoring a high replication capacity to viruses that possess combinations of the E138K mutation together with the M184I or M184V mutation (54). M184I/V RT is known to have lower enzyme processivity than WT RT, especially at low dNTP concentrations (6,15,48), and the M184I mutation is even more impaired than the M184V mutation in regard to processivity (18,24). Deficits of M184I/V RT in processivity and enzyme activity may be attributable to defective dNTP utilization (15,18,24,48,51).…”

Section: Evolution Of Hiv-1 Mutants Selected In Mt2 Cells and Cbmcs Umentioning

confidence: 99%

“…M184I/V RT is known to have lower enzyme processivity than WT RT, especially at low dNTP concentrations (6,15,48), and the M184I mutation is even more impaired than the M184V mutation in regard to processivity (18,24). Deficits of M184I/V RT in processivity and enzyme activity may be attributable to defective dNTP utilization (15,18,24,48,51). Now, we wished to investigate whether the compensatory effect of the E138K mutation on the M184I mutation might also be subunit specific, and accordingly, we performed single-cycle processivity assays at low dNTP concentrations with the recombinant RT enzymes p66 WT /p51 WT , p66 M184I /p51 WT , p66 M184I /p51 E138K , p66 M184IϩE138K /p51 E138K , and p66 M184IϩE138K /p51 WT (Fig.…”

Section: Evolution Of Hiv-1 Mutants Selected In Mt2 Cells and Cbmcs Umentioning

confidence: 99%

See 2 more Smart Citations

Subunit-Selective Mutational Analysis and Tissue Culture Evaluations of the Interactions of the E138K and M184I Mutations in HIV-1 Reverse Transcriptase

Oliveira

Quashie

et al. 2012

J Virol

Self Cite

View full text Add to dashboard Cite

The emergence of HIV-1 drug resistance remains a major obstacle in antiviral therapy. M184I/V and E138K are signature mutations of clinical relevance in HIV-1 reverse transcriptase (RT) for the nucleoside reverse transcriptase inhibitors (NRTIs) lamivudine (3TC) and emtricitabine (FTC) and the second-generation (new) nonnucleoside reverse transcriptase inhibitor (NNRTI) rilpivirine (RPV), respectively, and the E138K mutation has also been shown to be selected by etravirine in cell culture. The E138K mutation was recently shown to compensate for the low enzyme processivity and viral fitness associated with the M184I/V mutations through enhanced deoxynucleoside triphosphate (dNTP) usage, while the M184I/V mutations compensated for defects in polymerization rates associated with the E138K mutations under conditions of high dNTP concentrations. The M184I mutation was also shown to enhance resistance to RPV and ETR when present together with the E138K mutation. These mutual compensatory effects might also enhance transmission rates of viruses containing these two mutations. Therefore, we performed tissue culture studies to investigate the evolutionary dynamics of these viruses. Through experiments in which E138K-containing viruses were selected with 3TC-FTC and in which M184I/V viruses were selected with ETR, we demonstrated that ETR was able to select for the E138K mutation in viruses containing the M184I/V mutations and that the M184I/V mutations consistently emerged when E138K viruses were selected with 3TC-FTC. We also performed biochemical subunit-selective mutational analyses to investigate the impact of the E138K mutation on RT function and interactions with the M184I mutation. We now show that the E138K mutation decreased rates of polymerization, impaired RNase H activity, and conferred ETR resistance through the p51 subunit of RT, while an enhancement of dNTP usage as a result of the simultaneous presence of both mutations E138K and M184I occurred via both subunits.

show abstract

Section: Discussionmentioning

confidence: 99%

Section: Evolution Of Hiv-1 Mutants Selected In Mt2 Cells and Cbmcs Umentioning

confidence: 99%

Section: Evolution Of Hiv-1 Mutants Selected In Mt2 Cells and Cbmcs Umentioning

confidence: 99%

See 1 more Smart Citation

Subunit-Selective Mutational Analysis and Tissue Culture Evaluations of the Interactions of the E138K and M184I Mutations in HIV-1 Reverse Transcriptase

Oliveira

Quashie

et al. 2012

J Virol

Self Cite

View full text Add to dashboard Cite

show abstract

“…The sequences of DNA template D110 and primer D25 used for DNA-dependent DNA polymerase assay are as follows: 5=-GAATTAGATCGATGGGAAAAAATTCGGTTAAGGCC AGGGGGAAAGAAAAAATATAAATTAAAACATATAGTATGGGCAAG CAGGGAGCTAGAACGATTCGCAGTTAATCC-3= (D110) and 5=-GGAT TAACTGCGAATCGTTCTAGCT-3= (D25). For 5=-end labeling of oligonucleotides with [␥- 32 P]ATP, the Ambion KinaseMax kit was used, followed by purification through Ambion NucAway spin columns, according to protocols provided by the supplier (Invitrogen, Burlington, ON, Canada).…”

Section: Methodsmentioning

confidence: 99%

“…The M184V mutation confers high-level resistance to both 3TC and FTC and has a negative impact on enzyme processivity and viral replication capacity (RC) due to the fact that M184V-containing RT is defective in dNTP usage (31,32). Biochemical and virological data have demonstrated that N348I can complement this deficit of M184V (25,26).…”

mentioning

confidence: 96%

The Connection Domain Mutation N348I in HIV-1 Reverse Transcriptase Enhances Resistance to Etravirine and Rilpivirine but Restricts the Emergence of the E138K Resistance Mutation by Diminishing Viral Replication Capacity

Colby-Germinario

Oliveira

et al. 2014

J Virol

Self Cite

View full text Add to dashboard Cite

Clinical resistance to rilpivirine (RPV), a novel nonnucleoside reverse transcriptase (RT) inhibitor (NNRTI), is associated an E-to-K mutation at position 138 (E138K) in RT together with an M184I/V mutation that confers resistance against emtricitabine (FTC), a nucleoside RT inhibitor (NRTI) that is given together with RPV in therapy. These two mutations can compensate for each other in regard to fitness deficits conferred by each mutation alone, raising the question of why E138K did not arise spontaneously in the clinic following lamivudine (3TC) use, which also selects for the M184I/V mutations. In this context, we have investigated the role of a N348I connection domain mutation that is prevalent in treatment-experienced patients. N348I confers resistance to both the NRTI zidovudine (ZDV) and the NNRTI nevirapine (NVP) and was also found to be associated with M184V and to compensate for deficits associated with the latter mutation. Now, we show that both N348I alone and N348I/ M184V can prevent or delay the emergence of E138K under pressure with RPV or a related NNRTI, termed etravirine (ETR). N348I also enhanced levels of resistance conferred by E138K against RPV and ETR by 2.2-and 2.3-fold, respectively. The presence of the N348I or M184V/N348I mutation decreased the replication capacity of E138K virus, and biochemical assays confirmed that N348I, in a background of E138K, impaired RT catalytic efficiency and RNase H activity. These findings help to explain the low viral replication capacity of viruses containing the E138K/N348I mutations and how N348I delayed or prevented the emergence of E138K in patients with M184V-containing viruses.

show abstract

Single Active Site Mutation Causes Serious Resistance of HIV Reverse Transcriptase to Lamivudine: Insight from Multiple Molecular Dynamics Simulations

Moonsamy

Bhakat

Walker

et al. 2015

Cell Biochem Biophys

View full text Add to dashboard Cite

Molecular dynamics simulations, binding free energy calculations, principle component analysis (PCA), and residue interaction network analysis were employed in order to investigate the molecular mechanism of M184I single mutation which played pivotal role in making the HIV-1 reverse transcriptase (RT) totally resistant to lamivudine. Results showed that single mutations at residue 184 of RT caused (1) distortion of the orientation of lamivudine in the active site due to the steric conflict between the oxathiolane ring of lamivudine and the side chain of beta-branched amino acids Ile at position 184 which, in turn, perturbs inhibitor binding, (2) decrease in the binding affinity by (~8 kcal/mol) when compared to the wild-type, (3) variation in the overall enzyme motion as evident from the PCA for both systems, and (4) distortion of the hydrogen bonding network and atomic interactions with the inhibitor. The comprehensive analysis presented in this report can provide useful information for understanding the drug resistance mechanism against lamivudine. The results can also provide some potential clues for further design of novel inhibitors that are less susceptible to drug resistance.

show abstract

Multiple Effects of the M184V Resistance Mutation in the Reverse Transcriptase of Human Immunodeficiency Virus Type 1

Cited by 33 publications

References 35 publications

Subunit-Selective Mutational Analysis and Tissue Culture Evaluations of the Interactions of the E138K and M184I Mutations in HIV-1 Reverse Transcriptase

Subunit-Selective Mutational Analysis and Tissue Culture Evaluations of the Interactions of the E138K and M184I Mutations in HIV-1 Reverse Transcriptase

The Connection Domain Mutation N348I in HIV-1 Reverse Transcriptase Enhances Resistance to Etravirine and Rilpivirine but Restricts the Emergence of the E138K Resistance Mutation by Diminishing Viral Replication Capacity

Single Active Site Mutation Causes Serious Resistance of HIV Reverse Transcriptase to Lamivudine: Insight from Multiple Molecular Dynamics Simulations

Contact Info

Product

Resources

About