Multiple evolutionary origins of the fungus causing Panama disease of banana: Concordant evidence from nuclear and mitochondrial gene genealogies

Abstract

Panama disease of banana, caused by the fungus Fusarium oxysporum f. sp. cubense, is a serious constraint both to the commercial production of banana and cultivation for subsistence agriculture. Previous work has indicated that F. oxysporum f. sp. cubense consists of several clonal lineages that may be genetically distant. In this study we tested whether lineages of the Panama disease pathogen have a monophyletic origin by comparing DNA sequences of nuclear and mitochondrial genes. DNA sequences were obtained for translation elongation factor 1␣ and the mitochondrial small subunit ribosomal RNA genes for F. oxysporum strains from banana, pathogenic strains from other hosts and putatively nonpathogenic isolates of F. oxysporum. Cladograms for the two genes were highly concordant and a partition-homogeneity test indicated the two datasets could be combined. The tree inferred from the combined dataset resolved five lineages corresponding to ''F. oxysporum f. sp. cubense'' with a large dichotomy between two taxa represented by strains most commonly isolated from bananas with Panama disease. The results also demonstrate that the latter two taxa have significantly different chromosome numbers. F. oxysporum isolates collected as nonpathogenic or pathogenic to other hosts that have very similar or identical elongation factor 1␣ and mitochondrial small subunit genotypes as banana pathogens were shown to cause little or no disease on banana. Taken together, these results indicate Panama disease of banana is caused by fungi with independent evolutionary origins.

EF-1α gene and IGS rDNA sequencing of Fusarium oxysporum f. sp. vasinfectum and F. oxysporum f. sp. phaseoli reveals polyphyletic origin of strains

“…Our phylogenetic analyses showed that strains from the same formae speciales can have very distinct genetic backgrounds, supporting their polyphyletic origin and confirming the observations of several studies on the origin of formae speciales of F. oxysporum (O'Donnell et al, 1998;Baayen et al, 2000;Alves-Santos et al, 2002a;O'Donnell et al, 2009). Determinants of host-specificity may be horizontally transferred between strains of F. oxysporum of different lineages, resulting in polyphyly.…”

“…Phylogenetic studies of members of the FOSC using molecular tools such as multilocus sequencing typing (MLST) and amplified fragment length polymorphism (AFLP) have been allowed discrimination of formae speciales within FOSC, but many cases of polyphyletic origin of formae speciales have also been described (O'Donnell et al, 1998;Alves-Santos et al, 1999;Baayen et al, 2000;Lievens et al, 2007).…”

Morphology, Pathogenicity and Molecular Identification of Fusarium spp. Associated with Anise Seeds in Serbia

“…Four hundred seeds (4 trials, each with 100 seeds) from each locality were sterilized with NaOCl for 3 minutes and then rinsed with sterile water and transferred to old pure cultures and making use of DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer's instructions. The molecular identity of the fungus was confirmed by amplifying the partial translation elongation factor-1α (TEF) gene with the specific primers ef1 (ATGGGTAAGGAGGACAAGAC) and ef2 (GGAAGTACCAGTGATCATGTT) (O'Donnell et al, 1998).…”

Novel species of Cercospora and Pseudocercospora (Capnodiales, Mycosphaerellaceae) from Australia

“…The large subunit region of rDNA was amplified with LR0R and LR6 (Vilgalys & Hester 1990). Part of the translation elongation factor 1-a (EF-1a) gene was amplified with the primers EF1-728 F (Carbone & Kohn 1999) and EF2 (O'Donnell et al 1998). All PCRs were performed with high fidelity Phusion enzyme (New England Biolabs) according to the manufacturer's instructions.…”