Multipotent Genetic Suppression of Retrotransposon-Induced Mutations by Nxf1 through Fine-Tuning of Alternative Splicing

Concepcion, Dorothy; Flores-Garcia, Lisbeth; Hamilton, Bruce A.

doi:10.1371/journal.pgen.1000484

Cited by 13 publications

(25 citation statements)

References 60 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Positional complementation cloning identified the modifier as an amino acid substitution allele of mRNA nuclear export factor Nxf1 , suggesting a previously unexpected role for canonical mRNA export machinery in splicing fidelity in at least some contexts [69]. Importantly, this dose-responsive effect on alternative splicing has been demonstrated for six out of seven mutations caused by sense-strand IAP insertions in host gene introns, but none of 15 mutations with other classes of insertional events [70]. This creates an “inside-out” network module, with a modifier node acting on several different mutations, some of which have additional known modifiers (Figure 2B).…”

Section: Natural Variants: Keys To Genetic Plasticity?mentioning

confidence: 92%

Modifier Genes and the Plasticity of Genetic Networks in Mice

Hamilton

2012

PLoS Genet

Self Cite

View full text Add to dashboard Cite

Modifier genes are an integral part of the genetic landscape in both humans and experimental organisms, but have been less well explored in mammals than other systems. A growing number of modifier genes in mouse models of disease nonetheless illustrate the potential for novel findings, while new technical advances promise many more to come. Modifier genes in mouse models include induced mutations and spontaneous or wild-derived variations captured in inbred strains. Identification of modifiers among wild-derived variants in particular should detect disease modifiers that have been shaped by selection and might therefore be compatible with high fitness and function. Here we review selected examples and argue that modifier genes derived from natural variation may provide a bias for nodes in genetic networks that have greater intrinsic plasticity and whose therapeutic manipulation may therefore be more resilient to side effects than conventional targets.

show abstract

Section: Natural Variants: Keys To Genetic Plasticity?mentioning

confidence: 92%

Modifier Genes and the Plasticity of Genetic Networks in Mice

Hamilton

2012

PLoS Genet

Self Cite

View full text Add to dashboard Cite

show abstract

“…Genetic modifiers identified through activity on one gene of a pathway or network may often act on additional genes in the same pathway or on genes regulated through the same genetic mechanism (Moore et al 1990;Blewitt et al 2005;Concepcion et al 2009). From this perspective, it will be of interest to determine whether the A/J background can suppress other PI-signaling mutants, such as Inpp4a (Nystuen et al 2001), Fig4 (Chow et al 2007, and Vac14 Jin et al 2008), whose phenotypic similarities include tremor, premature lethality, degenerative pathology, and intracellular trafficking defects.…”

Section: Discussionmentioning

confidence: 99%

“…Animals were maintained on 12-hr light/dark cycles and with ad libitum access to food and water. Congenic B6-vb stock has been described (Floyd et al 2003;Concepcion et al 2009). B63129-Gnaq stock was the gift of Stefan Offermanns and Melvin I. Simon (Offermanns et al 1997a,b).…”

Section: Methodsmentioning

confidence: 99%

“…Molecular biology: Reverse transcription-quantitative PCR (RT-qPCR) using SYBR green fluorescence and Western blotting with infrared image quantification were performed using standard methods, adapted as described (Concepcion et al 2009). Primers for Pitpna were ACACGAGAAAGCCTG GAATG and GTTTATGCACATTCTCCTGG and for Ppig (cyclophilin), GGGACAGGGAAATCAACTCA and CCTCCTCTTCCA TTCCCTTC.…”

Section: Methodsmentioning

confidence: 99%

“…Positional complementation cloning identified Mvb1 with a wildderived Mus musculus castaneus allele of the nuclear export factor Nxf1 (Floyd et al 2003). Subsequent experiments show that this modifier suppresses mutations caused by intracisternal A particle endogenous retroviruses inserted into introns as a class, in each case by increasing the level of correctly spliced mRNA derived from the inserted allele (Concepcion et al 2009). In the case of vibrator, the increased RNA and protein level is sufficient to attenuate tremor and neurodegeneration phenotypes substantially and to eliminate most premature lethality (Hamilton et al 1997;Floyd et al 2003).…”

mentioning

confidence: 98%

See 2 more Smart Citations

Modifier Genes for Mouse Phosphatidylinositol Transfer Protein α (vibrator) That Bypass Juvenile Lethality

Concepcion

Johannes

et al. 2011

Genetics

Self Cite

View full text Add to dashboard Cite

Phosphatidylinositol transfer proteins (PITPs) mediate lipid signaling and membrane trafficking in eukaryotic cells. Loss-of-function mutations of the gene encoding PITPa in mice result in a range of dosagesensitive phenotypes, including neurological dysfunction, neurodegeneration, and premature death. We have previously reported genetic suppression of a strong hypomorphic allele, vibrator, by a wild-derived variant of Nxf1, which increases the level of PITPa made from vibrator alleles and suppresses each of the neurological and survival phenotypes. Here we report discovery and genetic mapping of additional vibrator modifiers, Mvb2 and Mvb3, from a different strain background that suppresses juvenile lethality without suppressing visible phenotypes or gene expression. Genotype-specific survival analysis predicts molecular heterosis at Mvb3. These results indicate a mechanism of suppression that bypasses a quantitative requirement for PITPa function.

show abstract

The RNA Transport Element of the Murine musD Retrotransposon Requires Long-range Intramolecular Interactions for Function

Łęgiewicz¹,

Zolotukhin

Pilkington

et al. 2010

Journal of Biological Chemistry

View full text Add to dashboard Cite

Retrovirus replication requires specialized transport mechanisms to export genomic mRNA from the nucleus to the cytoplasm of the infected cell. This regulation is mediated by a combination of viral and/or cellular factors that interact with cis-acting RNA export elements linking the viral RNA to the cellular CRM1 or NXF1 nuclear export pathways. Endogenous type D murine LTR retrotransposons (musD) were reported to contain an RNA export element located upstream of the 3-LTR. Although functionally equivalent, the musD export element, termed the musD transport element, is distinct from the other retroviral RNA export elements, such as the constitutive transport element of simian/Mason-Pfizer monkey retroviruses and the RNA transport element found in rodent intracisternal A-particle LTR retrotransposons. We demonstrate here that the minimal RNA transport element (musD transport element) of musD comprises multiple secondary structure elements that presumably serve as recognition signals for the cellular export machinery. We identified two classes of tertiary interactions, namely kissing loops and a pseudoknot. This work constitutes the first example of an RNA transport element requiring such structural motifs to mediate nuclear export.Post-transcriptional control is essential for expression of cellular and viral mRNAs, involving complex interactions of messenger ribonucleoproteins with transport receptors and components of the nuclear pore complex. Retroviruses depend on specialized transport mechanisms for nuclear export of full-length mRNA in their unspliced form because this transcript encodes the Gag-Pol polyprotein and additionally serves as the genomic RNA packaged into progeny virions in the cytoplasm. For HIV and all lentiviruses, the human T-cell leukemia virus family, endogenous human retroviruses, and mouse mammary tumor virus, transport of full-length mRNA depends on specific cis-acting RNA export signals that bind viral trans-acting factors and link the mRNA with the cellular CRM1 (chromosome region maintenance 1) export receptor (1, 2). In contrast, export and expression of the primary transcript of simple retroviruses and retroelements depend solely on cellular export machinery. Simian retrovirus and MasonPfizer monkey virus contain the cis-acting constitutive transport element (CTE) 3 (3, 4), and some rodent intracisternal A-particle LTR retroelements contain a CTE-like element designated the RNA transport element (RTE) (5, 6). These export elements represent interaction sites for cellular factors that provide a molecular link to the NXF1 (nuclear export factor 1) export receptor (7-9). Inactivating the retroviral export machinery by removing the cis-acting RNA element or trans-acting protein factors results in nuclear retention of the primary transcript and consequently impaired virus or retroelement production.Like the intracisternal A-particle LTR, the type D murine LTR retrotransposon (musD) and its derivative, ETn (early transposon), are mobile elements that share ancestry and genomic organizatio...

show abstract

Multipotent Genetic Suppression of Retrotransposon-Induced Mutations by Nxf1 through Fine-Tuning of Alternative Splicing

Cited by 13 publications

References 60 publications

Modifier Genes and the Plasticity of Genetic Networks in Mice

Modifier Genes and the Plasticity of Genetic Networks in Mice

Modifier Genes for Mouse Phosphatidylinositol Transfer Protein α (vibrator) That Bypass Juvenile Lethality

The RNA Transport Element of the Murine musD Retrotransposon Requires Long-range Intramolecular Interactions for Function

Contact Info

Product

Resources

About