Mutation Spectrum in Patients with Wiskott-Aldrich Syndrome and X-linked Thrombocytopenia: Identification of Twelve Different Mutations in the WASP Gene

Abstract

SummaryTwelve different mutations in the WASP gene were found in twelve unrelated families with Wiskott-Aldrich syndrome (WAS) or X-linked thrombocytopenia (XLT). Four frameshift, one splice, one nonsense mutation, and one 18-base-pair deletion were detected in seven patients with WAS. Only missense mutations were found in five patients diagnosed as having XLT. One of the nucleotide substitutions in exon 2 (codon 86) results in an Arg to Cys replacement. Two other nucleotide substitutions in this codon, R86L and R86H, have been reported previously, both giving rise to typical WAS symptoms, indicating a mutational hot spot in this codon. The finding of mutations in the WASP gene in both WAS and XLT gives further evidence of these syndromes being allelic. The relatively small size of the WASP gene facilitates the detection of mutations and a reliable diagnosis of both carriers and affected fetuses in families with WAS or XLT.

Mutations of the Wiskott-Aldrich Syndrome Protein (WASP): hotspots, effect on transcription, and translation and phenotype/genotype correlation

“…As was observed in smaller series reported previously, [9][10][11][15][16][17][18][19][20][21][22]30,35,39,43 the predominant mutations of WASP were missense mutations which were typically located in exons 1, 2, 3, and 4. Only 4 missense mutations, 1 each in exon 7, 9, 10, and 11, were observed downstream of exon 4.…”

Novel mutations in the Wiskott-Aldrich syndrome protein gene and their effects on transcriptional, translational, and clinical phenotypes

“…Patient underwent bone marrow transplantation. e Recurrent mutations, previously reported by Derry et al, 1995;Kolluri et al, 1995;Kwan et al, 1995a,b;Zhu et al, 1995;de Saint Basile et al, 1996;Greer et al, 1996;Schindelhauer et al, 1996;Schwartz et al, 1996;Remold-O'Donnell et al, 1997;Zhu et al, 1997;MacCarthy-Morrogh et al, 1998;Parolini et al, 1998. f Mutation creates (+) or destroys (-) restriction site. Transcripts represented in Figure 3.…”

Two novel activating mutations in the Wiskott-Aldrich syndrome protein result in congenital neutropenia

“…The polymerase chain reaction (PCR) was performed on DNA from peripheral blood leukocytes to amplify the GBD, VCA domain, and C-terminus of WAS (exons 7-9, 11, and 12); primers were modified slightly from those published by Schwartz et al 18 (exon 7, forward: GGTTGGTA-AGTGGGTCAATGAG, reverse: CCTCTGCCCCCAGGAATCTGT; exons 8, 9, and 11 as published; exon 12, forward: CACCAACCTC-CCAGGGCATCT, reverse: AGCACAGGGCAGCAAGTAACT), and reaction conditions were as previously described. 17,18 Products were bidirectionally sequenced using an Applied Biosystems 310 Analyser with BigDye version 2 terminator chemistry (Applied Biosystems, Foster City, CA).…”

“…17,18 Products were bidirectionally sequenced using an Applied Biosystems 310 Analyser with BigDye version 2 terminator chemistry (Applied Biosystems, Foster City, CA). Positive results were confirmed by restriction endonuclease digestion using the enzymes as specified.…”