Mutational spectrum of the iduronate 2 sulfatase gene in 25 unrelated Korean Hunter syndrome patients: Identification of 13 novel mutations

Abstract

Hunter syndrome (Mucopolysaccharidosis type II, MPS2) is an X-linked recessively inherited disease caused by a deficiency of iduronate 2 sulfatase (IDS). In this study, we investigated mutations of the IDS gene in 25 Korean Hunter syndrome patients. We identified 20 mutations, of which 13 mutations are novel; 6 small deletions (69_88delCCTCGGATCCGAAACGCAGG, 121-123delCTC, 500delA, 877_878delCA, 787delG, 1042_1049delTACAGCAA), 2 insertions (21_22insG, 683_684insC), 2 terminations (529G>T, 637A>T), and 3 missense mutations (353C>A, 779T>C, 899G>T). Moreover, using TaqI or HindIII RFLPs, we found three gene deletions. When the 20 mutations were depicted in a 3-dimensional model of IDS protein, most of the mutations were found to be at structurally critical points that could interfere with refolding of the protein, although they were located in peripheral areas. We hope that these findings will further the understanding of the underlying mechanisms associated with the disease.

An overview of Korean patients with mucopolysaccharidosis and collaboration through the Asia Pacific MPS Network

“…Because Hunter syndrome is an X-linked recessive disorder, in most cases the mutations causing the disorder are unique mutations, except when there is a shared X chromosome. The current authors reported finding 20 mutations in 25 Korean patients with MPS type II in 2003 (3). Thirty-one mutations in 49 Korean patients with MPS type II from 45 families were later reported in 2012 (4).…”

Otologic Manifestations of Hunter Syndrome and Their Relationship with Speech Development

“…This gene has been mapped to Xq27-28, and the disease severity appears to be related to the pattern of the mutation. Most mutations were observed at structurally critical points; these could interfere with protein refolding [Kim et al, 2003]. Nonsense mutations as well as major structural rearrangements appear to be associated with the severe phenotype; patients with missense mutations have more variable phenotypes that range from mild to severe [Hopwood et al, 1993;Rathmann et al, 1996].…”

Mutational and structural analysis of Japanese patients with mucopolysaccharidosis type II

“…Since then, a broad spectrum of mutations has been reported (Sukegawa et al 1992;Kim et al 2003). However, the molecular mechanisms of genotype/phenotypes have not been elucidated.…”