Mutations affecting the ability of Escherichia coli Lrp to bind DNA, activate transcription, or respond to leucine

Platko, Jill; Calvo, Joseph M.

doi:10.1128/jb.175.4.1110-1117.1993

Cited by 88 publications

(120 citation statements)

References 23 publications

Supporting

Mentioning

114

Contrasting

Order By: Relevance

“…Since DMS alkylates the N7 position of guanines in the major groove of the DNA helix the DMS protection patterns also demonstrate that, like other homodimeric helixturn-helix DNA binding proteins, the Lrp protomer binds in adjacent major grooves on the same face of the DNA helix. Together, these results support the sequence-derived inference that Lrp is a helix-turn-helix DNA binding protein (38 (Fig. 7) show that the primary consensus-like binding site (site 1) and the adjacent secondary binding site (site 2) are separated from one another by one integral turn of the DNA helix (Fig.…”

Section: Identification Of An Lrp Consensus-like Dna-binding Site In supporting

confidence: 74%

Leucine-responsive Regulatory Protein-DNA Interactions in the Leader Region of the ilvGMEDA Operon of Escherichia coli

Rhee

Parekh

Hatfield

1996

Journal of Biological Chemistry

View full text Add to dashboard Cite

The leucine-responsive regulatory protein, Lrp, 1 is a global regulatory protein of Escherichia coli that affects the expression of many operons (reviewed in Refs. 1 and 2). The expression of some target operons is activated by Lrp, while the expression of others is repressed. In addition, the free amino acid, L-leucine, acts as an effector ligand of Lrp; and, at some DNA target sites, L-leucine is required for Lrp binding. At other sites, L-leucine can antagonize or have no effect on Lrp-DNA interactions. In most cases, the physiological role of Lrp is to activate biosynthetic operons and to repress degradative ones. Therefore, it has been suggested that Lrp and L-leucine might function to coordinate metabolic shifts between nutritional feast and famine conditions. However, the metabolic coherence of the operons regulated by Lrp remains unclear.The structural gene for Lrp was initially identified as a mutation in a regulatory gene, livR, for the branched-chain amino acid (L-leucine, L-isoleucine, and L-valine) transport system (3). Subsequently, additional mutations in this gene that affected the biosynthesis of L-leucine were identified (4). Further studies showed that the protein product of this gene (now referred to as lrp) activates transcription of the ilvIH operon, which encodes one of the three acetohydroxy acid synthase (AHAS) isozymes required for the first step in the biosynthesis of the three branched-chain amino acids (4). Interestingly, many of the other operons regulated by Lrp are involved in either the production or the dissimilation of the carbon substrates, pyruvate and ␣-ketobutyrate, of the AHAS isozymes required for branched-chain amino acid biosynthesis (Fig. 1). For example, Lrp regulates the serA and sdaA genes involved in the production of pyruvate and the tdh and kbl genes, which affect the in vivo levels of L-threonine and ␣-ketobutyrate (5, 6). Also, Lrp regulates the expression of the leucine biosynthetic operon, leuABCD (7), and the expression of the branched-chain amino acid transport genes livJ and livKHMG (8). Thus, it appears that Lrp plays an important role in the maintenance of appropriate in vivo levels of the branched-chain amino acids. Such a role for Lrp in branched-chain amino acid metabolism is further underscored by the partial auxotrophy for the branched-chain amino acids observed in a lrp Ϫ strain of E. coli K12 (1).In E. coli, the biosynthesis of the branched-chain amino acids occurs via a parallel pathway catalyzed by several bifunctional enzymes ( Fig. 1) (9). The genes encoding these enzymes are specified by four separate operons (ilvBN, ilvGMEDA, ilvYC, and ilvIH). The ilvBN and ilvIH operons encode the genes for the subunits of the AHAS I and AHAS III isozymes, respectively (10). The ilvGMEDA operon encodes four of the five enzymes required for the biosynthesis of L-isoleucine and Lvaline (11). The ilvGM genes encode the subunits of AHAS I, while the remaining genes encode two other enzymes of the common pathway, dihydroxy-acid dehydratase (ilvD) and transamin...

show abstract

Section: Identification Of An Lrp Consensus-like Dna-binding Site In supporting

confidence: 74%

Leucine-responsive Regulatory Protein-DNA Interactions in the Leader Region of the ilvGMEDA Operon of Escherichia coli

Rhee

Parekh

Hatfield

1996

Journal of Biological Chemistry

View full text Add to dashboard Cite

show abstract

“…Based on information about the Lrp mutation reported by Platko & Calvo (1993), we replaced T227 and T371 of lrp with C and G, respectively, to obtain genes encoding V76A (activation mutant) and M124R (leucine response mutant) derivatives of Lrp. Targeted mutagenesis was performed on the pGEM-lrp plasmid by PCR with primers GCATCACTTCTGGCATTCGTTGAGATT and AATCTC AACGAATGCCAGAAGTGATGC (for V76A) or GCGTGCCGGATA GGTCAGCCTACCG and CGGTAGGCTGACCTATCCGGCACGC (for M124R), followed by treatment with DpnI.…”

Section: Methodsmentioning

confidence: 99%

“…The binding of leucine by Lrp either stimulates or reduces the promoter activity of its target genes or operons (Platko & Calvo, 1993). In addition, the non-specific binding of Lrp to DNA affects the expression of many genes, and this binding varies with the nutrient conditions and growth phase (Chen et al, 2001).…”

Section: Lrp Mediates the Butyrate Responsementioning

confidence: 99%

“…To examine the role of Lrp in the butyrate-sensing process, we constructed a plasmid encoding one of two Lrp derivatives: a constitutively active mutant, Lrp (V76A), and a 'response' mutant, Lrp (M124R) (Platko & Calvo, 1993), which does not respond to leucine, and expressed them from the Para promoter in the Dlrp mutant in medium containing 3.2 mM arabinose. The amounts of EspB and Tir protein in the strain expressing Lrp (V76A) grown with sodium chloride were comparable to those in the strain expressing wild-type Lrp grown with butyrate (Fig.…”

Section: Lrp Mediates the Butyrate Responsementioning

confidence: 99%

See 1 more Smart Citation

Regulation of virulence by butyrate sensing in enterohaemorrhagic Escherichia coli

Nakanishi

Tashiro²,

Kuhara³

et al. 2009

Microbiology

137

155

View full text Add to dashboard Cite

Enterohaemorrhagic Escherichia coli (EHEC) colonizes and proliferates at the mucosal surface, inducing severe diarrhoea. Short-chain fatty acids (SCFAs) are abundant in the intestine owing to the metabolic activity of microflora, and are important for colonic health. We found that, although a high concentration of SCFAs inhibited the growth of EHEC, at low concentrations, the SCFAs markedly enhanced the expression of the virulence genes required for cell adherence and the induction of attaching and effacing (A/E) lesions. Of the SCFAs tested, butyrate markedly enhanced the expression of these virulence-associated genes, even at the low concentration of 1.25 mM, but acetate and propionate showed only a small effect at concentrations higher than 40 mM. Butyrate enhanced the promoter activity of the LEE1 operon, which encodes a global regulator of the LEE genes, Ler. This enhancement was dependent on a regulator, PchA. Butyrate sensing was completely abrogated by the deletion of lrp, the gene for the leucine-responsive regulatory protein, Lrp. Expression of a constitutively active mutant of Lrp enhanced the expression of the LEE genes in the absence of butyrate, and a response-defective Lrp derivative reduced the response to butyrate. Thus, upon entering the distal ileum, EHEC may respond to the higher butyrate level via Lrp by increasing its virulence expression, leading to efficient colonization of the target niche.

show abstract

“…One of these pathways is controlled by the Lrp global transcription factor. Lrp homologs are small (ϳ19-kDa) DNA binding proteins that are widely conserved among bacteria and archaea (64,65). They are members of a larger conserved family of transcriptional regulators known as the feast/famine regulatory proteins.…”

Section: Phenotypic Variation In X Nematophilamentioning

confidence: 99%

Ready or Not: Microbial Adaptive Responses in Dynamic Symbiosis Environments

Cao

Goodrich‐Blair

2017

J Bacteriol

View full text Add to dashboard Cite

In mutually beneficial and pathogenic symbiotic associations, microbes must adapt to the host environment for optimal fitness. Both within an individual host and during transmission between hosts, microbes are exposed to temporal and spatial variation in environmental conditions. The phenomenon of phenotypic variation, in which different subpopulations of cells express distinctive and potentially adaptive characteristics, can contribute to microbial adaptation to a lifestyle that includes rapidly changing environments. The environments experienced by a symbiotic microbe during its life history can be erratic or predictable, and each can impact the evolution of adaptive responses. In particular, the predictability of a rhythmic or cyclical series of environments may promote the evolution of signal transduction cascades that allow preadaptive responses to environments that are likely to be encountered in the future, a phenomenon known as adaptive prediction. In this review, we summarize environmental variations known to occur in some well-studied models of symbiosis and how these may contribute to the evolution of microbial population heterogeneity and anticipatory behavior. We provide details about the symbiosis between Xenorhabdus bacteria and Steinernema nematodes as a model to investigate the concept of environmental adaptation and adaptive prediction in a microbial symbiosis.

show abstract

Mutations affecting the ability of Escherichia coli Lrp to bind DNA, activate transcription, or respond to leucine

Cited by 88 publications

References 23 publications

Leucine-responsive Regulatory Protein-DNA Interactions in the Leader Region of the ilvGMEDA Operon of Escherichia coli

Leucine-responsive Regulatory Protein-DNA Interactions in the Leader Region of the ilvGMEDA Operon of Escherichia coli

Regulation of virulence by butyrate sensing in enterohaemorrhagic Escherichia coli

Ready or Not: Microbial Adaptive Responses in Dynamic Symbiosis Environments

Contact Info

Product

Resources

About