NAD+-dependent ADP-ribosylation of T Lymphocyte Alloantigen RT6.1 Reversibly Proceeding in Intact Rat Lymphocytes

Abstract

Rat T lymphocyte alloantigen 6.1 (RT6.1), which was synthesized as the fusion protein with a maltose-binding protein in Escherichia coli, displayed NAD ؉ -dependent auto-ADP-ribosylation in addition to an enzyme activity of NAD ؉ glycohydrolase. Such ADP-ribosylation of RT6.1 was also observed in lymphocytes isolated from rat tissues as follows. When intact rat lymphocytes expressing RT6.1 mRNA were incubated with [␣-32 P]NAD ؉ , its radioactivity was incorporated into a cell surface protein with the M r of 31,000. The radiolabeled 31-kDa protein was released from the cell surface by treatment of the cells with phosphatidylinositol-specific phospholipase C and immunoprecipitated with anti-RT6.1 antiserum. The radioactivity incorporated into the 31-kDa protein was recovered as 5- ADP-ribosylation is one of the post-translational modifications of cellular proteins, in which the ADP-ribose moiety of NAD ϩ is transferred to specific amino acid residues of mostly GTP-binding proteins. This unique modification has been found in enzyme reactions catalyzed by bacterial toxins such as diphtheria, cholera, and pertussis toxins (1-3). Enzyme activities of bacterial ADP-ribosyltransferases have widely been utilized to identify and characterize the substrate proteins, because the protein functions are profoundly affected by ADPribosylation. Besides these bacterial toxins, activities of ADPribosyltransferases appeared to be present in several mammalian cells (4 -8). One of the mammalian enzymes, NAD ϩ : arginine ADP-ribosyltransferase, of which ADP-ribose acceptor was initially identified as the guanidino group of arginine or its related compounds, was purified from rabbit skeletal muscle (5). Zolkiewska et al. (6) have recently cloned a cDNA encoding the enzyme protein with a possible structure of glycosylphosphatidylinositol (GPI 1 )-anchored protein. An ecto-enzyme activity of NAD ϩ :arginine ADP-ribosyltransferase was also found in myogenically differentiated C2C12 cells, and its substrate was identified as a cell surface adhesion molecule, integrin ␣7 (7). The NAD ϩ -dependent ADP-ribosylation of integrin ␣7 was markedly reduced after treatment of the cells with phosphatidylinositol-specific phospholipase C, indicating that the enzyme was indeed anchored in the cell surface via GPI linkage (7). Based on a homology search with the amino acid sequences of this type of mammalian enzymes, RT6 alloantigen was expected to have a similar enzyme activity (6, 8 -10).RT6 alloantigen is specifically expressed in the cell surface of T lymphocytes (11), although it is not detected in thymocytes, bone marrow cells, or B lymphocytes (11), suggesting that its expression is restricted to the final stages of post-thymic T lymphocyte development. Although the physiological role of RT6 in a specific cell function is still unknown, its defect in lymphocytes has been implicated in disorders of diabetes and mercury-induced renal autoimmunity in animal models (12)(13)(14). Recent biochemical analysis reveals that there are at least two types o...

Increase in ADP‐ribosyltransferase activity of rat T lymphocyte alloantigen RT6.1 by a single amino acid mutation

“…Complementary DNAs of rat RT6.1 and RT6.2 were isolated by reverse transcriptase-polymerase chain reaction using the 5' primer of CCGGATCCATGCTAGACACGGCTCC (nucleotides corresponding to amino acids 26-31 are underlined) and the 3' primer of CCGGATCCCTAGCTGTATAAGCAATTGT (inverse complement of nucleotides encoding amino acids 241-246 is underlined) as described previously [10]. For site-directed mutagenesis of Q207E, amplified cDNA of RT6.1 was subcloned into a phagemid vector, pBluescript II SK(-) (Stratagene).…”

“…These truncated cDNAs were inserted into an expression plasmid, pMAL-cRI (New England Biolabs). MBP-fusion proteins of RT6.1, RT6.2, and Q207E (henceforth referred to as MBPtrRT6.1, MBP-trRT6.2, and MBP-Q207E, respectively) were expressed in E. coli JM109 cells and then purified as described previously [10]. Protein was quantitated using a Bio-Rad Protein Assay Kit with bovine serum albumin as a standard protein.…”

“…Auto-ADP-ribosylation of the recombinant proteins was performed as described previously [10]. ADP-ribosylation of agmatine was carried out in 20 gl of a mixture consisting of 50 mM sodium phosphate (pH 6.5), 50 mM NaCI, 0.5% (w/v) 3-[(3-cholamidopropyl)dimethylammonio]-l-propanesulfonate, 37 laM [ct-32p]NAD+ (148 kBq), 2 mM agmatine, and 1 lag of the recombinant proteins.…”

“…We have recently reported that rat T lymphocyte alloantigen RT6.1, which is also a GPI-linked protein, displays auto-ADP-ribosylation in intact rat lymphocytes [10]. The automodification, however, proceeded with extremely low stoichiometry in a recombinant RT6.1 purified from E. coli [10].…”

“…The automodification, however, proceeded with extremely low stoichiometry in a recombinant RT6.1 purified from E. coli [10]. Haag et al [11] also reported that RT6.2, an allelic form of RT6.1, exhibited auto-ADP-ribosylation in intact cells, while they showed that such modification was not significantly observed for RT6.1.…”