Nano-hydroxyapatite enhanced double network hydrogels with excellent mechanical properties for potential application in cartilage repair

Gan, Shuchun; Lin, Weinan; Zou, Yongliang; Xu, Bo; Zhang, Xiong; Zhao, Jianhao; Rong, Jian

doi:10.1016/j.carbpol.2019.115523

Cited by 74 publications

(51 citation statements)

References 37 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…A,B) Plots of the compressive versus tensile strength and modulus for BC–PVA–PAMPS (this work) and other strong hydrogels (see Table S1 in the Supporting Information for data and references). [ 13–35 ] The multiple data points for BC–PVA–PAMPS are for different compositions. C) BC–PVA–PAMPS easily bears the weight of a 100 lb.…”

Section: Introductionmentioning

confidence: 99%

A Synthetic Hydrogel Composite with the Mechanical Behavior and Durability of Cartilage

Yang

Zhao

Koshut

et al. 2020

Adv Funct Materials

216

178

View full text Add to dashboard Cite

This article reports the first hydrogel with the strength and modulus of cartilage in both tension and compression, and the first to exhibit cartilage‐equivalent tensile fatigue strength at 100 000 cycles. These properties are achieved by infiltrating a bacterial cellulose (BC) nanofiber network with a poly(vinyl alcohol) (PVA)–poly(2‐acrylamido‐2‐methyl‐1‐propanesulfonic acid sodium salt) (PAMPS) double network hydrogel. The BC provides tensile strength in a manner analogous to collagen in cartilage, while the PAMPS provides a fixed negative charge and osmotic restoring force similar to the role of aggrecan in cartilage. The hydrogel has the same aggregate modulus and permeability as cartilage, resulting in the same time‐dependent deformation under confined compression. The hydrogel is not cytotoxic, has a coefficient of friction 45% lower than cartilage, and is 4.4 times more wear‐resistant than a PVA hydrogel. The properties of this hydrogel make it an excellent candidate material for replacement of damaged cartilage.

show abstract

Section: Introductionmentioning

confidence: 99%

A Synthetic Hydrogel Composite with the Mechanical Behavior and Durability of Cartilage

Yang

Zhao

Koshut

et al. 2020

Adv Funct Materials

216

178

View full text Add to dashboard Cite

show abstract

“…[ 47 ] All gene expression data were normalized to β‐actin. The sequences of the primers for GAG, COL I, COL II and OCN were as follows [ 14 ] : Aggrecan: 5′‐GCTACGACGCCATCTGCTACAC‐3′; Collagen I: 5′‐GCGTAGCCTACATGGACCAACAG‐3′; Collagen II 1: 5′‐GCCAC‐GCTCAAGTCCCTCAAC‐3′; OCN: 5′‐AGGGCAGCGAGG TGGT‐GAAG‐3′.…”

Section: Methodsmentioning

confidence: 99%

“…developed a dual physically cross‐linked poly(vinyl alcohol)‐(nano hydroxyapatite)/(2‐hydroxypropyltrimethyl ammonium chloride chitosan) (PVA‐HA/HACC‐Cit) hydrogels with DN and used for cartilage repair through a simply freezing/thawing technique and an immersing process. [ 14 ] Sethuraman et al. developed an injectable semi‐interpenetrating network hydrogel construct with chondroitin sulfate nanoparticles (ChS‐NPs) and hydroxyapatite (HA), and co‐cultured with osteoblasts and chondrocytes in gradient hydrogels, which showed layer‐specific retention of cells and cell–cell interaction at the interface.…”

Section: Introductionmentioning

confidence: 99%

Gradient Mineralized and Porous Double‐Network Hydrogel Effectively Induce the Differentiation of BMSCs into Osteochondral Tissue In Vitro for Potential Application in Cartilage Repair

Fan

Chen

Zhang

et al. 2020

Macromolecular Bioscience

View full text Add to dashboard Cite

At present, it is a considerable challenge to mimic the complex architecture of osteochondral (OC) tissue. In this study, a porous and gradient mineralized double‐network hydrogel is synthesized and used to induce bone marrow mesenchymal stem cells (BMSCs) to differentiate into the desired OC tissue depending only on the material and mechanical properties. Physical and chemical characterizations show that hydroxyapatite nanoparticles grow and fill into the pores of the hydrogel, and their content presents a gradient change in different layers of hydrogel. The synthesized hydrogel has excellent mechanical properties and the compression strength with different mineralization degrees varies from 27 to 380 kPa, which fully meets the needs of increased mechanical strength of articular cartilage from the surface to the deep layer. Besides, the synthesized hydrogel has good biocompatibility that can promote the proliferation and growth of BMSCs. More importantly, the results of histochemistry, immunohistochemistry, and real time polymerase chain reaction show that gradient mineralized hydrogel can induce BMSCs to differentiate into the desired chondrocytes and osteoblasts in different layers of hydrogels, indicating that OC tissues can be successfully constructed through a simple induction differentiation of gradient mineralized hydrogel.

show abstract

“…A strengthening network is usually added during hydrogel preparation. The most frequent situation is adding a strengthening network to form a double‐network (DN) structure with the original PVA network, [ 66,67 ] while some studies add two strengthening networks to form a triple‐network (TN) hydrogel. [ 68 ] There are mainly four types of available strengthening materials.…”

Section: Strengthening Mechanisms and Basic Property Characterizationmentioning

confidence: 99%

PVA‐Based Hydrogels: Promising Candidates for Articular Cartilage Repair

Chen

Song

Wang

et al. 2021

Macromolecular Bioscience

View full text Add to dashboard Cite

The complex, gradient physiological structure of articular cartilage is a severe hindrance of its self‐repair, leaving the clinical treatment of cartilage defects a demanding issue to be addressed. Currently applied tissue engineering treatments and traditional non‐tissue engineering treatments have different limitations, for example, cell dedifferentiation, immune rejection, and prosthesis‐related complications. Thus, studies have been focusing on seeking promising candidates for novel cartilage repair methods. Polyvinyl alcohol (PVA) hydrogels with excellent biocompatibility and tunable material properties have become the alternatives. For pure PVA hydrogels, the mechanical strength and lubricity are not capable of replacing articular cartilage until proper modifications are done. This paper summarizes the research progress in PVA hydrogels, including the preparation, modification, and cartilage‐repair‐aimed biomimetic improvements. Design guidance of PVA hydrogels is put forward as assistance to functional hydrogel preparation. Finally, the prospects and main obstacles of PVA hydrogels are discussed.

show abstract

Nano-hydroxyapatite enhanced double network hydrogels with excellent mechanical properties for potential application in cartilage repair

Cited by 74 publications

References 37 publications

A Synthetic Hydrogel Composite with the Mechanical Behavior and Durability of Cartilage

A Synthetic Hydrogel Composite with the Mechanical Behavior and Durability of Cartilage

Gradient Mineralized and Porous Double‐Network Hydrogel Effectively Induce the Differentiation of BMSCs into Osteochondral Tissue In Vitro for Potential Application in Cartilage Repair

PVA‐Based Hydrogels: Promising Candidates for Articular Cartilage Repair

Contact Info

Product

Resources

About