Natural variants and editing events provide insights into routes for spike architecture modification in common wheat

Fan, Min; Zhang, Xiaoyu; Nagarajan, R.; Zhai, Wenxuan; Rauf, Yahya; Jia, Haiyan; Ma, Zhengqiang; Yan, Liuling

doi:10.1016/j.cj.2022.04.009

Cited by 4 publications

(1 citation statement)

References 47 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Based on the flanking sequences at both ends of the microsatellites, primers for microsatellites were designed using Primer 3 v2.3.6 (http://primer3.sourceforge.net) under default settings, with the size of PCR products ranging from 100 to 300 bp. The universal FAM tail (GAAGGTGACCAAGTTCATGCT; Chao et al, 2022;Fan et al, 2023) was added to the 5' end of forward primers (Wuhan Tianyi Huayu Gene Technology Co., Ltd.). PCR amplification was performed in a total reaction volume of 25 mL that included 12.5mL 2 ×PCR Master Mix, 0.2mL forward primer (10mmol/L), 0.6 mL reverse primer (10mmol/L), 0.4mL FAM labeled primer (10mmol/L), 100ng template DNA, and finally supplemented with ddH 2 O. Amplification was performed according to the following procedure: one cycle at 95 °C for 2min for initial denaturation, 30 cycles of: denaturation at 95 °C for 20sec, annealing at 50-55 °C for 20sec, and extension at 72 °C for 20sec, eight cycles of: denaturation at 95 °C for 20sec, annealing at 53 °C for 20sec, and extension at 72 °C for 30sec, and lastly a final extension at 72 °C for 5min.…”

Section: Methodsmentioning

confidence: 99%

Microsatellite markers for Monitipora digitata designed using restriction-site associated DNA sequencing

Jia

Chen

et al. 2023

Front. Mar. Sci.

View full text Add to dashboard Cite

Montipora digitata is a species belonging to the Acroporidae. In the Indo-Pacific region, M. digitata is widely distributed and is the dominant species of scleractinian coral in the South China Sea, however, there are currently no molecular markers suitable for assessing the species genetic diversity. Here, restriction-site associated DNA sequencing (RAD-seq) was used to isolate and characterize polymorphic microsatellite loci. A total of 317,361 RAD-tags were obtained using RAD-seq, including 6,778 microsatellite loci. Primer pairs for 106 loci were ordered and twenty-one polymorphic loci, that amplified reliably were identified. The number of alleles per locus were 2-7, observed heterozygosity was 0.111-0.556 with an average value of 0.285, and expected heterozygosity was 0.105- 0.802, with an average value of 0.536. Before Bonferroni correction 13 loci deviated significantly from the expectations of Hardy-Weinberg equilibrium (P < 0.05), after correction, two microsatellite loci deviated significantly (P < 0.0002). The polymorphic information content (PIC) ranged from 0.100-0.778, with 12 loci highly polymorphic (PIC > 0.5), six moderately polymorphic (0.25 < PIC < 0.5), and three loci with low polymorphism (PIC < 0.25). The microsatellite loci developed here will be effective tools for conservation genetic research on M. digitata.

show abstract

Section: Methodsmentioning

confidence: 99%

Microsatellite markers for Monitipora digitata designed using restriction-site associated DNA sequencing

Jia

Chen

et al. 2023

Front. Mar. Sci.

View full text Add to dashboard Cite

show abstract

Gene Editing of Wheat to Reduce Coeliac Disease Epitopes in Gluten

Smulders,

Gilissen,

Juranić

et al. 2023

A Roadmap for Plant Genome Editing

View full text Add to dashboard Cite

By using gene editing technologies such as CRISPR/Cas, precise modifications can be made in the genome. CRISPR/Cas is especially valuable for targeted mutagenesis in polyploids, as it can induce mutations of multiple alleles simultaneously, to obtain regenerants that are homozygous for the desired mutation. A range of gene-edited traits have been developed in hexaploid bread wheat, including various nutrition and health-related traits, plant architecture, pest and disease resistance, tolerance to abiotic stress, and traits that enable more efficient breeding. Wheat is also known as a cause of some human diseases, particularly coeliac disease (CD), with a prevalence of 1–2% of the population. In the EU alone, at least 4.5 million people suffer from it. CD is a chronic inflammation of the small intestine, induced and maintained in genetically predisposed individuals by the consumption of gluten proteins from wheat, barley and rye. As there is no cure, patients must follow a life-long gluten-free diet. The dominant epitopes in gluten proteins that trigger the disease, have been characterized, but they cannot be removed by classical breeding without affecting baking quality, as it concerns over 100 gluten genes that occur partly as blocks of genes in the genome of wheat. Using gene editing, two studies have shown that it is possible to modify the epitopes in several alpha- and gamma-gliadins simultaneously, while deleting some of the genes completely. In some lines more than 80% of the alpha-gliadin genes were modified. These proof-of-principle studies show that it is feasible to use gene editing, along with other breeding approaches, to completely remove the CD epitopes from bread wheat. Gene-edited coeliac-safe wheat will have economic, social and environmental impact on food security, nutrition and public health, but the realisation will (partially) depend on new European legislation for plants produced by gene editing.

show abstract

Morpho-Colorimetric Diversity and Genome-Wide Association Study of Wheat Spike Architecture Based on Image Processing Under Well-Watered and Rain-Fed Conditions

Abdi,

Alipour,

Bernousi

et al. 2024

J Plant Growth Regul

View full text Add to dashboard Cite

Natural variants and editing events provide insights into routes for spike architecture modification in common wheat

Cited by 4 publications

References 47 publications

Microsatellite markers for Monitipora digitata designed using restriction-site associated DNA sequencing

Microsatellite markers for Monitipora digitata designed using restriction-site associated DNA sequencing

Gene Editing of Wheat to Reduce Coeliac Disease Epitopes in Gluten

Morpho-Colorimetric Diversity and Genome-Wide Association Study of Wheat Spike Architecture Based on Image Processing Under Well-Watered and Rain-Fed Conditions

Contact Info

Product

Resources

About