Near-infrared fluorescent northern blot

Abstract

Northern blot analysis detects RNA molecules immobilized on nylon membranes through hybridization with radioactive P-labeled DNA or RNA oligonucleotide probes. Alternatively, nonradioactive northern blot relies on chemiluminescent reactions triggered by horseradish peroxidase (HRP) conjugated probes. The use of regulated radioactive material and the complexity of chemiluminescent reactions and detection have hampered the adoption of northern blot techniques by the wider biomedical research community. Here, we describe a sensitive and straightforward nonradioactive northern blot method, which utilizes near-infrared (IR) fluorescent dye-labeled probes (irNorthern). We found that irNorthern has a detection limit of ∼0.05 femtomoles (fmol), which is slightly less sensitive thanP-Northern. However, we found that the IR dye-labeled probe maintains the sensitivity after multiple usages as well as long-term storage. We also present alternative irNorthern methods using a biotinylated DNA probe, a DNA probe labeled by terminal transferase, or an RNA probe labeled during in vitro transcription. Furthermore, utilization of different IR dyes allows multiplex detection of different RNA species. Therefore, irNorthern represents a more convenient and versatile tool for RNA detection compared to traditional northern blot analysis.

HRPK-1, a conserved KH-domain protein, modulates microRNA activity during Caenorhabditis elegans development

“…All remaining steps of the RNA purification were performed as previously described [47]. Northern blotting was performed as described [49], using the following probe sequences: mir-84 (TCTACAATATTACATACTACCTCA), mir-58 (ATTGCCGTACTGAACGATCTCA), let-7 (AACTATACAACCTACTACCTCA), and U6 (TTGCGTGTCATCCTTGCGCAGG). Fluorescent signal intensity was measured using ImageJ.…”

Repurposing Antiviral Drugs for Orthogonal RNA‐Catalyzed Labeling of RNA

“…RNA labeling with biotin by FJ ribozymes may serve for enrichment of specific RNAs by affinity pulldown, and biotinylated RNA could be stained indirectly with fluorescently labeled streptavidin or anti‐biotin antibodies . However, direct fluorescent labeling with small organic fluorophores would be significantly preferred for fluorescence spectroscopy or RNA imaging.…”

Repurposing Antiviral Drugs for Orthogonal RNA‐Catalyzed Labeling of RNA

“…RNA labeling with biotin by FJ ribozymes may serve for enrichment of specific RNAs by affinity pulldown, and biotinylated RNA could be stained indirectly with fluorescently labeled streptavidin or anti-biotin antibodies. [19] However, direct fluorescent labeling with small organic fluorophores would be significantly preferred for fluorescence spectroscopy or RNA imaging. In this respect, fluorescent tenofovir analogues or derivatives with bioorthogonal functional groups for conjugation of fluorophores by established techniques are desirable as ribozyme substrates.…”