Neogenesis and maturation of transient Golgi-like cisternae in a simple eukaryote

Štefanić, Saša; Morf, Laura; Kulangara, Caroline; Regös, Attila; Sonda, Sabrina; Schraner, Elisabeth M.; Spycher, Cornelia; Wild, Peter J.; Hehl, Adrian B.

doi:10.1242/jcs.049411

Cited by 62 publications

(124 citation statements)

References 64 publications

Supporting

Mentioning

115

Contrasting

Order By: Relevance

“…To investigate the nature of the fi rst N-terminal hydrophobic sequence, HA tags were introduced at the N-terminal end either of the full-length GlGCS or of a variant lacking the fi rst hydrophobic stretch (aa [3][4][5][6][7][8][9][10][11][12][13][14][15][16][17][18][19][20][21][22]. Both reporters showed an equivalent signal and distribution, indicating that, like the mammalian homolog, the parasite protein is not proteolytically processed to remove the fi rst hydrophobic sequence (data not shown).…”

Section: Discussionmentioning

confidence: 99%

“…Stable chromosomal integration of the described constructs was performed using the pPacV-Integ expression vector ( 21 ) using XbaI and PacI restriction sites. Oligonucleotides (5 ′ -3 ′ orientation) used in this study were: GCS(2-537)-SbfI -s AGATCTCCTG-CAGGACGGGTTGACTCTCTCCTTAGTG; GCS(23-537)-SbfI -s AGATCTCCTGCAGGCTGTCAACCGCATAAGTG; GCS-PacI -as CGTTAATT AATCAGTCGAGGGATTTTTTATTGGCCTG;GCS-HA-PacI -asCGTTAATTAATCACGCGT AGTCTGG GACATCGTA TGGGTAGTCGAGGGATTTTTTATTGGCCTG.…”

Section: Expression Vector Construction and Transfectionmentioning

confidence: 99%

“…To investigate whether GlGCS is regulated during parasite stage differentiation, we analyzed the levels of GlGCS mRNA in encysting cells at 7 h after induction, the time when RNA transcription of encystation-specifi c genes peaks ( 21 ). Microarray analysis showed a signifi cant increase of mRNA for the sphingolipid synthesis enzymes GlGCS and serine palmitoyltransferase 2 in encysting cells compared with trophozoites ( Fig.…”

Section: G Lamblia Gcs Regulation During Encystationmentioning

confidence: 99%

See 2 more Smart Citations

Glucosylceramide synthesis inhibition affects cell cycle progression, membrane trafficking, and stage differentiation in Giardia lamblia

Štefanić

Spycher

Morf

et al. 2010

Journal of Lipid Research

Self Cite

View full text Add to dashboard Cite

Ceramide, a central molecule in the sphingolipid biosynthesis, plays a critical role as second messenger in cellular signaling that regulates antiproliferative processes, including apoptosis, cell differentiation, and cell cycle arrest in different cell types. Levels of ceramide, a highly bioactive molecule, must be tightly controlled by diverse, coordinated mechanisms, including ceramide degradation, phosphorylation, or sphingolipid metabolism. Glucosylceramide synthase (GCS), also defi ned as ceramide glucosyltransferase (CGT), metabolizes ceramide to glucosylceramide (GlcCer), a glycosylated form of ceramide that does not have antiproliferative activity. GCS plays a crucial role in cell survival after apoptotic stimuli, Abstract Synthesis of glucosylceramide via glucosylceramide synthase (GCS) is a crucial event in higher eukaryotes, both for the production of complex glycosphingolipids and for regulating cellular levels of ceramide, a potent antiproliferative second messenger. In this study, we explored the dependence of the early branching eukaryote Giardia lamblia on GCS activity. Biochemical analyses revealed that the parasite has a GCS located in endoplasmic reticulum (ER) membranes that is active in proliferating and encysting trophozoites. Pharmacological inhibition of GCS induced aberrant cell division, characterized by arrest of cytokinesis, incomplete cleavage furrow formation, and consequent block of replication. Importantly, we showed that increased ceramide levels were responsible for the cytokinesis arrest. In addition, GCS inhibition resulted in prominent ultrastructural abnormalities, including accumulation of cytosolic vesicles, enlarged lysosomes, and clathrin disorganization. Moreover, anterograde traffi cking of the encystations-specifi c protein CWP1 was severely compromised and resulted in inhibition of stage differentiation. Our results reveal novel aspects of lipid metabolism in G. lamblia and specifically highlight the vital role of GCS in regulating cell cycle progression, membrane traffi cking events, and stage differentiation in this parasite. In addition, we identifi ed ceramide as a potent bioactive molecule, underscoring the universal conservation of ceramide signaling in eukaryotes. -Štefanić,

show abstract

Section: Discussionmentioning

confidence: 99%

Section: Expression Vector Construction and Transfectionmentioning

confidence: 99%

Section: G Lamblia Gcs Regulation During Encystationmentioning

confidence: 99%

See 1 more Smart Citation

Glucosylceramide synthesis inhibition affects cell cycle progression, membrane trafficking, and stage differentiation in Giardia lamblia

Štefanić

Spycher

Morf

et al. 2010

Journal of Lipid Research

Self Cite

View full text Add to dashboard Cite

show abstract

“…Some groups proposed a similarity between the ESVs and the Golgi complex [47,52,[63][64][65] supported by: (1) COPI and COPII association with the ESVs [47]; (2) the ESVs are sensitive for Brefeldin A, a drug known to inhibits the anterograde Golgi cisternae movement [63]; (3) the ESVs dependence of GTPases Sar1 and Arf1 for biogenesis and maturation, respectively [64]. However, the ESVs present some characteristics that do not fit with those presented by a classical Golgi: (1) the ESVs appear only during the encystation process; (2) no classical Golgi markers such as GM130, galactosyl transferases or the trans-Golgi network marker Rab6 are present in the parasite; (3) the ESVs do not present morphological characteristics that define this organelle as a Golgi, in accordance with parameters that have been well defined for many years.…”

Section: Golgi Complexmentioning

confidence: 99%

The Endomembrane System of Giardia intestinalis

Midlej¹,

Souza²,

Benchimol³

2017

Current Topics in Giardiasis

View full text Add to dashboard Cite

Giardia intestinalis is a protozoan that colonizes the small intestine of virtually all mammals, adhering to the mucosal epithelial cells. It is a cosmopolitan parasite and agent of giardiasis, which can lead to human diarrheal diseases. The Giardia life cycle presents two forms-the trophozoite and the cyst-which are responsible for infection and transmission, respectively. This cell has been considered an excellent model for evolutionary studies, even though there are controversial hypotheses as to whether this parasite is an early eukaryote or not. G. intestinalis has a unique and very basic endomembrane system. The trophozoite gathers a very small pack of membrane-bounded structures: nuclei, endoplasmic reticulum (ER), peripheral vesicles (PV) and mitosomes. These organelles are involved in many functions from regulatory aspects in gene expression as well as membrane traffic events. Two functional nuclei are observed in the parasite; they are always located symmetrically in the anterior region of the trophozoite. The ER and PV commonly share and accumulate functions in the secretory pathway, they are responsible for endocytosis and digestion processes. The mitosome is a mitochondriarelated organelle that does not produce ATP and lacks several mitochondrial characteristics. During the parasite differentiation into cyst, different types of vesicles appear into the cell body: the encystation specific vesicles (ESVs) and the encystation carbohydratepositive vesicles (ECVs). These vesicles work together to form the parasite's cyst wall in order to ensure that the cell reaches the cyst stage. Interestingly, Giardia does not present a morphologically recognized Golgi apparatus. It has been claimed that during the encystation process, the ESVs could represent a Golgi-like structure, because this organelle presents some characteristics of that high eukaryotic Golgi apparatus. In this book chapter, we highlight the G. intestinalis endomembrane system, emphasizing their morphology, proteins involved in its organization as well as their functional role.

show abstract

“…At that point, instead of continuing on into cytokinesis, the cell internalizes its flagella as the cyst wall rapidly forms. At the same time, cyst wall components are being produced and transported to the periphery of the cell, a process that appears to be independent from, albeit simultaneous with, the nuclear division (Stefanic et al, 2009). In addition, although trophozoites in the early stages of encystation display larger rounded ESVs, by the time the nuclear division takes place, the cyst wall components have been transported to the periphery of the cell and exist in a more diffuse network, as previously reported (Konrad et al, 2010).…”

Section: Nuclei Are Inherited In Non-identical Pairsmentioning

confidence: 99%

Nuclear Inheritance and Genetic Exchange without Meiosis in the Binucleate ParasiteGiardia intestinalis

Carpenter

Assaf

Gourguechon

et al. 2012

Journal of Cell Science

View full text Add to dashboard Cite

SummaryThe protozoan parasite Giardia intestinalis (also known as Giardia lamblia) is a major waterborne pathogen. During its life cycle, Giardia alternates between the actively growing trophozoite, which has two diploid nuclei with low levels of allelic heterozygosity, and the infectious cyst, which has four nuclei and a tough outer wall. Although the formation of the cyst wall has been studied extensively, we still lack basic knowledge about many fundamental aspects of the cyst, including the sources of the four nuclei and their distribution during the transformation from cyst into trophozoite. In this study, we tracked the identities of the nuclei in the trophozoite and cyst using integrated nuclear markers and immunofluorescence staining. We demonstrate that the cyst is formed from a single trophozoite by a mitotic division without cytokinesis and not by the fusion of two trophozoites. During excystation, the cell completes cytokinesis to form two daughter trophozoites. The non-identical nuclear pairs derived from the parent trophozoite remain associated in the cyst and are distributed to daughter cells during excystation as pairs. Thus, nuclear sorting (such that each daughter cell receives a pair of identical nuclei) does not appear to be a mechanism by which Giardia reduces heterozygosity between its nuclei. Rather, we show that the cyst nuclei exchange chromosomal genetic material, perhaps as a way to reduce heterozygosity in the absence of meiosis and sex, which have not been described in Giardia. These results shed light on fundamental aspects of the Giardia life cycle and have implications for our understanding of the population genetics and cell biology of this binucleate parasite.

show abstract

Neogenesis and maturation of transient Golgi-like cisternae in a simple eukaryote

Cited by 62 publications

References 64 publications

Glucosylceramide synthesis inhibition affects cell cycle progression, membrane trafficking, and stage differentiation in Giardia lamblia

Glucosylceramide synthesis inhibition affects cell cycle progression, membrane trafficking, and stage differentiation in Giardia lamblia

The Endomembrane System of Giardia intestinalis

Nuclear Inheritance and Genetic Exchange without Meiosis in the Binucleate ParasiteGiardia intestinalis

Contact Info

Product

Resources

About