New Chromosomal AmpC β-Lactamase in Enterobacter cloacae

Abstract

Several members of the Enterobacteriaceae, including Enterobacter spp., are naturally resistant to amoxicillin and cephalosporins. Enterobacter cloacae produces chromosomally encoded ␤-lactamases, also called cephalosporinases (1), and is a serious nosocomial pathogen, the third most prevalent bacterium isolated in intensive care settings (5,8). We report here the study of a new chromosomal AmpC ␤-lactamase produced by E. cloacae FFUL2En isolated from the blood culture of a patient hospitalized in a medicine ward of Hospital de Santa Maria, Lisbon, Portugal. The antibiogram revealed resistance to aminopenicillins, aztreonam, and broad-spectrum cephalosporins, except imipenem, aminoglycosides, and quinolones. By isoelectrofocusing, the sonicate extracts expressed a pI of 8.68, suggesting the presence of a presumed AmpC enzyme.A total DNA preparation from E. cloacae FFUL2En was used in PCR experiments with two sets of primers, TN5 (5Ј-CGTTT GTCAGGCACAGTCAAATCCA) and TN4 (5Ј-TTACTGTAG CGCGTCGAGGATATGG) and the internal primers TN2 (5Ј-TTCCACTGCGGCTGCCAGT) and TN3 (5Ј-CGGATGAGG TCACGGATAACGCC), designed in accordance with consensus sequences from the ampC genes described for E. cloacae and available at GenBank. The amplicon with 1,234 bp was cloned into the SmaI site of the pBK-CMV vector (6) with a TOPO TA cloning kit, resulting in the plasmid p2En1. The ␤-lactam susceptibility pattern of Escherichia coli 2En1, harboring the recombinant plasmid p2En1, displayed cefoxitin, cefuroxime, ceftazidime, and piperacillin plus tazobactam MICs of Ͼ256 g/ml and a cefepime MIC of 0.5 g/ml. The MICs of cefotaxime and aztreonam were lower than those for the parental strain (Table 1). The E. coli 2En1 transformant showed the same pI as the parental strain (pI 8.68), and the substrate profile of the enzyme EcloFFUL2En was determined with the transformant crude enzymatic extract (7). The V max values indicate that cephalothin, with a V max of 3,000.1 M/min, is hydrolyzed more quickly than cefoxitin (V max ϭ 3.7 M/min). Ceftazidime and cefotaxime are not hydrolyzed at detectable levels (V max ϭ Ͻ0.1 M/min).

In vitro Evaluation of Biofield Treatment on Enterobacter cloacae: Impact on Antimicrobial Susceptibility and Biotype

“…The existing literatures clearly mentioned that the organism E. cloacae has revealed its resistance to aminopenicillins, aztreonam and broad-spectrum cephalosporins [3]. In this experiment, the biofield treated lyophilized form of microbe showed very satisfactory result both qualitative as well as quantitative aspect by lowering the MIC value (≤8 µg/mL) of aztreonam and ceftazidime as compared to untreated group (Tables 2 and 3).…”

“…Many of the EN species have multiple antibiotic resistance that are undetectable in in vitro, which makes it difficult to treat in patients those are infected with this microbes. Based on existing literatures it was clearly mentioned that the organism E. cloacae had its resistance to aminopenicillins, aztreonam and broadspectrum cephalosporins [3]. The organisms are capable of overproducing AmpC β-lactamases by derepression of a chromosomal gene conferring the antibiotic resistance [4].…”

Digital multiplex ligation assay for highly multiplexed screening of β-lactamase-encoding genes in bacterial isolates

“…1). In addition to the ESBL-encoding genes detected and confirmed by PCR, intrinsic resistance genes that were universally detected were the chromosomally encoded AmpC-type β-lactamases bla ADC , bla PDC , and bla MIR , detected in all (and only) the 17 Acinetobacter baumannii, 12 Pseudomonas aerugonisa, and one Enterobacter cloacae isolates, respectively, as well as the chromosomally-encoded oxacillinase bla OXA-51-family in all A. baumannii group isolates [18][19][20][21][22] . dMLA also detected the chromosomally-encoded bla SHV in all five Klebsiella pneumoniae isolates 23 .…”

Cloning and functional characterization of the ambler Class C β-lactamase ofYersinia ruckeri

“…AmpC YRC‐1 did not share sufficient sequence identity with known plasmid‐mediated enzymes to be proposed as a progenitor. It was 74% and 73% identical to the chromosomal β‐lactamases of Enterobacter cloacae (Coneicao et al , 2004) and Enterobacter aerogenes (Preston et al , 2000), respectively, which were the closest AmpC enzymes (Fig. 1).…”