New member of the hormone-sensitive lipase family from the permafrost microbial community

Petrovskaya, L. E.; Novototskaya-Vlasova, Ksenia A.; Gapizov, Sultan Sh.; Спирина, Е.В.; Durdenko, E. V.; Rivkina, Elizaveta

doi:10.1080/21655979.2016.1230571

Cited by 14 publications

(17 citation statements)

References 17 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…This enzyme was isolated from a metagenomic library obtained from a Siberian permafrost sample. It demonstrated typical cold-adapted behavior, including a low-temperature optimum (30 • C) and low stability at elevated temperatures [22]. In the current study, we have shown that the thermal inactivation of PMGL3 is accompanied by the formation of oligomers and high molecular weight aggregates.…”

Section: Introductionsupporting

confidence: 52%

“…The mutant genes were constructed by two-step SOE (splicing with overlap extension)-PCR using wild-type PMGL3 gene as a template with Pfu DNA polymerase, and primers C49V for CCGAGGGCGTTTTGATCGAGC and C49Vrev GCTCGATCAAAACGCCCTCGG for the C49V mutant; C207F for CTGACCGGATTCTCGGCG and C207Frev CCGCCGAGAATCCGGTCAG for the C207F mutant. The resulting products were cloned into the pET32a vector, as described in [22]. Mutations were confirmed by DNA sequencing (Evrogen).…”

Section: Gene Cloning and Mutant Constructionmentioning

confidence: 99%

“…Previously, we have expressed a cold-active esterase PMGL3 from a permafrost metagenomic library and demonstrated that it possessed maximum activity at 30 • C with p-nitrophenyl butyrate (C4) as a substrate. PMGL3 demonstrated low thermal stability as incubation for 60 min at 50 • C led to its complete inactivation [22].…”

Section: Thermal Inactivation Of Pmgl3 Is Accompanied By Oligomerizationmentioning

confidence: 99%

See 2 more Smart Citations

Thermal Inactivation of a Cold-Active Esterase PMGL3 Isolated from the Permafrost Metagenomic Library

et al. 2019

View full text Add to dashboard Cite

PMGL3 is a cold-adapted esterase which was recently isolated from the permafrost metagenomic library. It exhibits maximum activity at 30 °C and low stability at elevated temperatures (40 °C and higher). Sequence alignment has revealed that PMGL3 is a member of the hormone-sensitive lipase (HSL) family. In this work, we demonstrated that incubation at 40 °C led to the inactivation of the enzyme (t1/2 = 36 min), which was accompanied by the formation of tetramers and higher molecular weight aggregates. In order to increase the thermal stability of PMGL3, its two cysteines Cys49 and Cys207 were substituted by the hydrophobic residues, which are found at the corresponding positions of thermostable esterases from the HSL family. One of the obtained mutants, C207F, possessed improved stability at 40 °C (t1/2 = 169 min) and increased surface hydrophobicity, whereas C49V was less stable in comparison with the wild type PMGL3. Both mutants exhibited reduced values of Vmax and kcat, while C207F demonstrated increased affinity to the substrate, and improved catalytic efficiency.

show abstract

Section: Introductionsupporting

confidence: 52%

Section: Gene Cloning and Mutant Constructionmentioning

confidence: 99%

Section: Thermal Inactivation Of Pmgl3 Is Accompanied By Oligomerizationmentioning

confidence: 99%

See 1 more Smart Citation

Thermal Inactivation of a Cold-Active Esterase PMGL3 Isolated from the Permafrost Metagenomic Library

et al. 2019

View full text Add to dashboard Cite

show abstract

“…Several HSL-like enzymes have been reported from microbial sources, such as RmEstB from the thermophilic fungus Rhizomucor miehei [11], PMGL2 from a permafrost bacterium Psychrobacter cryohalolentis [12], and E25 HSL esterase from a surface sediment sample E505 collected from the South China Sea [13]. Even though there are many reported HSL-like esterase from psychrophilic microorganisms on heterologous expression and biochemical characterisation, there are few reports on HSL-like esterase specifically from psychrophilic yeast.…”

Section: Introductionmentioning

confidence: 99%

Expression, Characterisation and Homology Modelling of a Novel Hormone-Sensitive Lipase (HSL)-Like Esterase from Glaciozyma antarctica

et al. 2020

View full text Add to dashboard Cite

Microorganisms, especially those that survive in extremely cold places such as Antarctica, have gained research attention since they produce a unique feature of the protein, such as being able to withstand at extreme temperature, salinity, and pressure, that make them desired for biotechnological application. Here, we report the first hormone-sensitive lipase (HSL)-like esterase from a Glaciozyma species, a psychrophilic yeast designated as GlaEst12-like esterase. In this study, the putative lipolytic enzyme was cloned, expressed in E. coli, purified, and characterised for its biochemical properties. Protein sequences analysis showed that GlaEst12 shared about 30% sequence identity with chain A of the bacterial hormone-sensitive lipase of E40. It belongs to the H group since it has the conserved motifs of Histidine-Glycine-Glycine-Glycine (HGGG)and Glycine-Aspartate-Serine-Alanine-Glycine (GDSAG) at the amino acid sequences. The recombinant GlaEst12 was successfully purified via one-step Ni-Sepharose affinity chromatography. Interestingly, GlaEst12 showed unusual properties with other enzymes from psychrophilic origin since it showed an optimal temperature ranged between 50–60 °C and was stable at alkaline pH conditions. Unlike other HSL-like esterase, this esterase showed higher activity towards medium-chain ester substrates rather than shorter chain ester. The 3D structure of GlaEst12, predicted by homology modelling using Robetta software, showed a secondary structure composed of mainly α/β hydrolase fold, with the catalytic residues being found at Ser232, Glu341, and His371.

show abstract

“…We have revealed different substrate specificities and various temperature optima of these enzymes demonstrating the broad spectrum of enzymatic activities which could be provided by the genome even of a single bacterium [29][30][31][32]. Screening of the metagenomic DNA library obtained from the permafrost-derived microcosm lead to the cloning of several genes coding for potential lipolytic enzymes [21,33]. Among them, a new esterase PMGL2 belonging to the hormone sensitive lipase (HSL, EC 3.1.1.79) family (family IV lipases) was produced and biochemically characterized [21].…”

Section: Introductionmentioning

confidence: 99%

Crystal structure of PMGL2 esterase from the hormone-sensitive lipase family with GCSAG motif around the catalytic serine

et al. 2020

Self Cite

View full text Add to dashboard Cite

Lipases comprise a large class of hydrolytic enzymes which catalyze the cleavage of the ester bonds in triacylglycerols and find numerous biotechnological applications. Previously, we have cloned the gene coding for a novel esterase PMGL2 from a Siberian permafrost metagenomic DNA library. We have determined the 3D structure of PMGL2 which belongs to the hormone-sensitive lipase (HSL) family and contains a new variant of the active site motif, GCSAG. Similar to many other HSLs, PMGL2 forms dimers in solution and in the crystal. Our results demonstrated that PMGL2 and structurally characterized members of the GTSAG motif subfamily possess a common dimerization interface that significantly differs from that of members of the GDSAG subfamily of known structure. Moreover, PMGL2 had a unique organization of the active site cavity with significantly different topology compared to the other lipolytic enzymes from the HSL family with known structure including the distinct orientation of the active site entrances within the dimer and about four times larger size of the active site cavity. To study the role of the cysteine residue in GCSAG motif of PMGL2, the catalytic properties and structure of its double C173T/C202S mutant were examined and found to be very similar to the wild type protein. The presence of the bound PEG molecule in the active site of the mutant form allowed for precise mapping of the amino acid residues forming the substrate cavity.

show abstract

New member of the hormone-sensitive lipase family from the permafrost microbial community

Cited by 14 publications

References 17 publications

Thermal Inactivation of a Cold-Active Esterase PMGL3 Isolated from the Permafrost Metagenomic Library

Thermal Inactivation of a Cold-Active Esterase PMGL3 Isolated from the Permafrost Metagenomic Library

Expression, Characterisation and Homology Modelling of a Novel Hormone-Sensitive Lipase (HSL)-Like Esterase from Glaciozyma antarctica

Crystal structure of PMGL2 esterase from the hormone-sensitive lipase family with GCSAG motif around the catalytic serine

Contact Info

Product

Resources

About