No Implication of Simian virus 40 in pathogenesis of Malignant Pleural Mesothelioma in Slovenia

Hmeljak, Julija; Kern, Izidor; Cör, Andrej

doi:10.1177/030089161009600504

Cited by 9 publications

(9 citation statements)

References 22 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Tumor tissue specimens were routinely formalin-fixed and paraffin-embedded. Genomic DNA from formalin-fixed and paraffin-embedded tissue was extracted as previously described [40]. A Qiagen FlexiGene kit (Qiagen, Hilden, Germany) was used for extraction of genomic DNA from frozen wholeblood samples.…”

Section: Dna Extraction and Genotypingmentioning

confidence: 99%

The influence of gemcitabine pathway polymorphisms on treatment outcome in patients with malignant mesothelioma

Erčulj

Kovač

Hmeljak

et al. 2012

Pharmacogenetics and Genomics

Self Cite

View full text Add to dashboard Cite

show abstract

Section: Dna Extraction and Genotypingmentioning

confidence: 99%

The influence of gemcitabine pathway polymorphisms on treatment outcome in patients with malignant mesothelioma

Erčulj

Kovač

Hmeljak

et al. 2012

Pharmacogenetics and Genomics

Self Cite

View full text Add to dashboard Cite

show abstract

“…The other putative aetiological factor, Semian virus 40, was not implicated in pathogenesis of malignant pleural mesothelioma in Slovenia 23,24…”

Section: Discussionmentioning

confidence: 95%

Improved survival after introduction of chemotherapy for malignant pleural mesothelioma in Slovenia: Population-based survey of 444 patients

Kovač¹,

Zwitter²,

Žagar³

2012

Radiology and Oncology

View full text Add to dashboard Cite

BackgroundMalignant pleural mesothelioma is a rare tumour with increasing frequency throughout the world. Due to long latency after exposure to asbestos, restrictions in the production and use of asbestos have not yet alleviated the burden of mesothelioma. During the last decade, several trials confirmed the benefit of systemic treatment with drugs such as doublets with cisplatina and gemcitabine or pemetrexed for carefully selected patients in good performance status. The purpose of this survey was to assess the impact of systemic treatment for the whole national population of patients with mesothelioma.Patients and methods.A retrospective study included all patients in Slovenia with histologically confirmed diagnosis of malignant pleural mesothelioma in the period from 1974 till 2008. Data from the Cancer Registry of Slovenia were supplemented by review of clinical records of the Institute of Oncology in Ljubljana where virtually all non-surgical treatment for mesothelioma was performed. We analysed the incidence, treatment, and survival of patients treated in the era of infrequent chemotherapy (1974–2003, the first period) and after it (2004–2008, the second period).ResultsThe survey included 444 patients, of whom 325 and 119 were diagnosed in the first and second period, respectively. Joinpoint regression analysis showed that after 1995 the trend in crude incidence rates increased more rapidly; the annual change was 0.03 per 100,000 per year before 1995 and 0.06 per 100,000 per year after. There was clear male predominance (70%) throughout the period covered by the survey. The proportion of patients above 65 years of age increased from 41.8% to 54.6% for the first and second period, respectively (p = 0.02). With a total of 52 (11.7%) operated patients, surgical treatment was rare and used only for selected patients with early disease and without comorbidity, leading to their relatively long median survival of 13.6 months. Chemotherapy was applied to 56 (17.2%) and to 96 (80.7%) patients during the first and second period, respectively. While a variety of older drugs were used in the first period, the most common regimen in the second period (applied to 91 patients) was doublet of low-dose gemcitabine in prolonged infusion and cisplatin. For the whole population of patients regardless the mode of treatment, median survival was 7.4 and 12.6 months (p-value = 0.037) for the first and second period, respectively.ConclusionsIncreasing incidence, male predominance and increased proportion of older patients confirm that the burden of mesothelioma persists in spite of a 15-years old ban in the production of asbestos. Modern chemotherapy, and in particular treatment with low-dose gemcitabine in prolonged infusion and cisplatin significantly prolonged median survival of patients with malignant pleural mesothelioma in Slovenia.

show abstract

“…NCI and non‐template control (NTC) were also included in each run. Additionally, amplification of the human glyceraldehyde‐3‐phosphate dehydrogenase (GADPH) gene with forward primer (G1) 5′‐TCCCTGAGCTGAACGGGAAG‐3′ and reverse primer (G2) 5′‐CGCCTGCTTCACCACCTTCT‐3′ (Hmeljak et al ., ) was used as a control of DNA isolation and PCR inhibition.…”

Section: Methodsmentioning

confidence: 99%

“…DNA extracted from Staphylococcus aureus NCI and non-template control (NTC) were also included in each run. Additionally, amplification of the human glyceraldehyde-3-phosphate dehydrogenase (GADPH) gene with forward primer (G1) 5′-TCCCTGAGCTGAACGG-GAAG-3′ and reverse primer (G2) 5′-CGCCTGCTTCAC-CACCTTCT-3′ (Hmeljak et al, 2010) was used as a control of DNA isolation and PCR inhibition. All PCR mixtures were conducted in a total volume of 15 lL and consisted of 1.5 lL of isolated DNA, 0.5 lM of each primer, 7.5 lL of QantiTect â SYBR â Green PCR Master Mix kit (Qiagen) and 5.25 lL of nuclease-free water (DEPC-treated).…”

Section: Detection Of Bacteriamentioning

confidence: 99%

Comparison of molecular and culture method in diagnosis of prosthetic joint infection

Rak

Barlič–Maganja

Kavčič

et al. 2013

FEMS Microbiol Lett

View full text Add to dashboard Cite

Diagnosis of prosthetic joint infection with culture technique can be problematic since the causative agent(s) are not possible to cultivate in all cases. Molecular methods had been evaluated in many studies but their inclusion in routine diagnostics is still controversial. The purpose of our prospective study was to compare the diagnostic accuracy of broad-range (BR)-PCR and culture technique. Intraoperative samples of periprosthetic tissue were retrieved in 67 patients undergoing revision arthroplasty. Samples were analyzed with culture technique, immunohistochemistry and BR 16S rRNA gene PCR. Bacteria in PCR-positive samples were identified using two different methods: direct sequencing of PCR products and specific TaqMan assays. In 63 cases, full concordance was found between BR-PCR and culture technique. Specific TaqMan assays failed to identify bacteria in four culture- and BR-PCR-positive cases and therefore had a lower sensitivity in comparison with BR-PCR. Molecular methods detected bacteria with the same accuracy as culture; however, identification of bacteria was inferior to culture. Further development of species-recognition techniques is required to improve identification of causative microorganisms.

show abstract

No Implication of Simian virus 40 in pathogenesis of Malignant Pleural Mesothelioma in Slovenia

Abstract: We found no evidence of SV40 presence in tissue samples from 103 Slovenian patients with malignant pleural mesothelioma. Asbestos exposure remains the main risk factor for malignant pleural mesothelioma in Slovenia.

Cited by 9 publications

References 22 publications

The influence of gemcitabine pathway polymorphisms on treatment outcome in patients with malignant mesothelioma

The influence of gemcitabine pathway polymorphisms on treatment outcome in patients with malignant mesothelioma

Improved survival after introduction of chemotherapy for malignant pleural mesothelioma in Slovenia: Population-based survey of 444 patients

Comparison of molecular and culture method in diagnosis of prosthetic joint infection

Contact Info

Product

Resources

About