Noggin4 is a long-range inhibitor of Wnt8 signalling that regulates head development in Xenopus laevis

Abstract

Noggin4 is a Noggin family secreted protein whose molecular and physiological functions remain unknown. In this study, we demonstrate that in contrast to other Noggins, Xenopus laevis Noggin4 cannot antagonise BMP signalling; instead, it specifically binds to Wnt8 and inhibits the Wnt/β -catenin pathway. Live imaging demonstrated that Noggin4 diffusivity in embryonic tissues significantly exceeded that of other Noggins. Using the Fluorescence Recovery After Photobleaching (FRAP) assay and mathematical modelling, we directly estimated the affinity of Noggin4 for Wnt8 in living embryos and determined that Noggin4 fine-tune the Wnt8 posterior-to-anterior gradient. Our results suggest a role for Noggin4 as a unique, freely diffusing, long-range inhibitor of canonical Wnt signalling, thus explaining its ability to promote head development.

Bioinformatic screening of genes present only in well regenerating vertebrates reveals novel FGF and purinergic signaling modulator - c-Answer

“…Our algorithm predicts the same set of lost genes for more recent GenBank sequencing data. S1 Table Supplementary Table S1 Name ("Myc reverse") described in (Eroshkin et al, 2016).…”

“…To obtain 3'-fragment of c-Answer-Myc cDNA we performed PCR from pCS2-WT c-Answer with a reverse primer WT c-Answer -XhoI: 5'-CCTCGAGGTTTACATGACCAGGGGCTGTG and a mixture of two forward primers taken in ratio of 1:10, respectively (Myc-tag-encoding sequences are underlined): 5'-GAGCAGAAACTCATCTCTGAAGAGGATCTGGGTCCAGAGTACCCAGTTCTG ("c-Answer-Myc forward") and 5'-GAACAGAAGCTGATATCGGAGGAAGACCTCGAGCAGAAACTCATCTCTG ("Myc forward") described in (Eroshkin et al, 2016).…”

Mechano‐sensitive regulation of gene expression during the embryonic development

“…First, mechanical tensions can serve as long-range agents, acting over large distances, in contrast to gradients of morphogens, which usually act more locally [see, for example, (Eroshkin et al, 2016;Plouhinec, Zakin, Moriyama, & De Robertis, 2013)]. Thus, they can play crucial roles in embryogenesis, coupling morphogenesis with cell differentiation.…”

Genome Editing of Wnt-1, a Gene Associated with Segmentation, via CRISPR/Cas9 in the Pine Caterpillar Moth, Dendrolimus punctatus

“…In Lepidoptera, including Manduca sexta and B. mori, Wnt-1 contributes to the posterior growth and segmentation processes (Kraft and Jäckle, 1994; Zhang et al, 2015). In other species of vertebrate and invertebrate, Wnt -signaling genes are involved in the head morphogenesis and appendage development (Heisenberg et al, 2001; Müller et al, 2007; Lewis et al, 2008; Eroshkin et al, 2016). …”

“…A similar phenotype was obtained from Masterblind / Axin1 mutation, which showed smaller head and eyes in zebrafish (Heisenberg et al, 2001). In Xenopus laevis, Noggin4 regulates head development by inhibiting Wnt8 signaling (Eroshkin et al, 2016). In mouse, DKK ( Dickkopf -related protein 1) as one of Wnt antagonists, is expressed anteriorly to repress Wnt signaling in the head (Lewis et al, 2008).…”