Non-coding 7S RNA inhibits transcription via mitochondrial RNA polymerase dimerization

Zhu, Xuefeng; Xie, Xie; Das, Hrishikesh; Tan, Benedict G.; Shi, Yonghong; Al-Behadili, Ali; Peter, Bradley; Motori, Elisa; Valenzuela, Sebastian; Posse, Viktor; Gustafsson, Claes M.; Hållberg, Bengt; Falkenberg, Maria

doi:10.1016/j.cell.2022.05.006

Cited by 37 publications

(23 citation statements)

References 66 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…26 This assay was adapted from previously published methods. 21 The primer sequences are listed below 27 : 7S RNA: Fwd (5′-3′): GCCACTTTCCACACAGACATC, Rev (5′-3′): GGCTGGTGTTAGGGTTCTTTG; GAPDH: Fwd (5′-3′): AGGTCGGAGTCAACGGATTT, Rev (5′-3′): TCTCGCTCCTGGAA-GATGG. For each primer, a 10 µL PCR reaction contained 2 µL total cDNA, a final concentration of 200 nM for each forward and reverse primer, and 1Â SsoAdvanced Universal SYBR Green Supermix (BioRad, 1725274).…”

Section: Plasma Collectionmentioning

confidence: 99%

“…20 Recently, 7S RNA, a lncRNA molecule in mitochondria, has been identified as a gene regulator that controls mitochondrial transcription both in vitro and in cultured human cells. 21 The changes in 7S RNA expression could modify mitochondrial translation and subsequently mitochondrial function. 22 However, the expression and the roles of 7S RNA in diseases, including DVT, remain largely unknown.…”

mentioning

confidence: 99%

See 1 more Smart Citation

Association of Circulating Long Noncoding 7S RNA with Deep Vein Thrombosis

Wang,

Memon,

Hedelius

et al. 2023

Semin Thromb Hemost

View full text Add to dashboard Cite

Mitochondrial dysfunction is a recognized factor in the pathogenesis of deep vein thrombosis (DVT). The role of 7S RNA, a long noncoding RNA that plays an important role in mitochondrial function, in DVT remains unclear. In this study, we aimed to investigate the potential use of 7S RNA as a biomarker in DVT. Plasma samples were obtained from 237 patients (aged 16–95 years) with suspected DVT recruited in a prospective multicenter management study (SCORE) where 53 patients were objectively confirmed with a diagnosis of DVT and the rest were diagnosed as non-DVT. 7S RNA was measured using quantitative real-time polymerase chain reaction in plasma samples. The plasma expression of 7S RNA was significantly lower in DVT compared with non-DVT (0.50 vs. 0.95, p = 0.043). With the linear regression analysis, we showed that the association between the plasma expression of 7S RNA and DVT (β = −0.72, p = 0.007) was independent of potential confounders. Receiver-operating characteristic curve analysis showed the area under the curve values of 0.60 for 7S RNA. The findings of the present study showed a notable association between 7S RNA and DVT. However, further investigations are needed to fully elucidate the exact role of 7S RNA in the pathophysiology of DVT and its diagnostic value.

show abstract

Section: Plasma Collectionmentioning

confidence: 99%

mentioning

confidence: 99%

Association of Circulating Long Noncoding 7S RNA with Deep Vein Thrombosis

Wang,

Memon,

Hedelius

et al. 2023

Semin Thromb Hemost

View full text Add to dashboard Cite

show abstract

“…4); this included the promoter for transcription of the light strand (LSP, OEUF 0.53) and conserved sequence block 3 (CSB3, OEUF 0.33). CSB3 was recently shown to be essential for the function of 7S RNA, a key regulator of transcription initiation in the mitochondria 43 . In contrast, the hypervariable sequences (HVS1-3) within the control region showed OEUF values ranging from 0.90-1.09; these regions are known to be highly polymorphic, and therefore were expected to be tolerant of variation.…”

Section: Mainmentioning

confidence: 99%

Quantifying constraint in the human mitochondrial genome

Lake

Liu

Battle

et al. 2022

Preprint

View full text Add to dashboard Cite

Mitochondrial DNA (mtDNA) has an important, yet often overlooked, role in health and disease. Constraint models quantify depletion of genetic variation by negative selection, representing a powerful tool for identifying deleterious variation underlying human phenotypes1-4. However, a constraint model for the mtDNA had not been developed, due to the unique features of this genome. Here we describe the development of a mitochondrial constraint model and its application to the Genome Aggregation Database (gnomAD), a large-scale population dataset reporting mtDNA variation across 56,434 humans5. Our results demonstrate strong depletion of expected variation, showing most pathogenic mtDNA variants remain undiscovered. To aid their identification, we compute constraint metrics for every protein, transfer RNA, and ribosomal RNA gene in the human mtDNA, as well as for non-coding regions. This includes assessment of regional or positional constraint within every gene, and local constraint for every base position. We identify enrichment of pathogenic variation in the most constrained sites, which include loci typically overlooked in mtDNA analyses, and show that the most constrained gene regions and non-coding elements encode functionally-critical sites. Lastly, we demonstrate how these metrics can improve the discovery of mtDNA variation underlying rare and common human phenotypes.

show abstract

“…The H-strand primary transcript contains mRNAs for 12 OXPHOS subunits, 2 rRNAs (12S and 16S), and 14 tRNAs 10 . The L-strand primary transcript contains 1 mRNA that encodes subunit 6 of NADH dehydrogenase (ND6), 8 tRNAs, and non-coding RNAs (ncRNAs) like 7S ncRNA that regulates transcription initiation 11 . In both strands, the rRNAs and most mRNAs are flanked by tRNAs, whose processing by endoribonuclease (RNase) P and RNase Z (ELAC2) yields the individual transcripts [12][13][14] .…”

Section: Introductionmentioning

confidence: 99%

The human mitochondrial mRNA structurome reveals mechanisms of gene expression

Conor Moran,

Brivanlou,

Brischigliaro

et al. 2023

Preprint

View full text Add to dashboard Cite

SummaryThe mammalian mitochondrial genome encodes thirteen oxidative phosphorylation system proteins, crucial in aerobic energy transduction. These proteins are translated from 9 monocistronic and 2 bicistronic transcripts, whose native structures remain unexplored, leaving fundamental molecular determinants of mitochondrial gene expression unknown. To address this gap, we developed a mitoDMS-MaPseq approach and used DREEM clustering to resolve the native human mitochondrial mt-mRNA structurome. We gained insights into mt-mRNA biology and translation regulatory mechanisms, including a unique programmed ribosomal frameshifting for theATP8/ATP6transcript. Furthermore, absence of the mt-mRNA maintenance factor LRPPRC led to a mitochondrial transcriptome structured differently, with specific mRNA regions exhibiting increased or decreased structuredness. This highlights the role of LRPPRC in maintaining mRNA folding to promote mt-mRNA stabilization and efficient translation. In conclusion, our mt-mRNA folding maps reveal novel mitochondrial gene expression mechanisms, serving as a detailed reference and tool for studying them in different physiological and pathological contexts.

show abstract

Non-coding 7S RNA inhibits transcription via mitochondrial RNA polymerase dimerization

Cited by 37 publications

References 66 publications

Association of Circulating Long Noncoding 7S RNA with Deep Vein Thrombosis

Association of Circulating Long Noncoding 7S RNA with Deep Vein Thrombosis

Quantifying constraint in the human mitochondrial genome

The human mitochondrial mRNA structurome reveals mechanisms of gene expression

Contact Info

Product

Resources

About