Nongastric H-K-ATPase in rodent prostate: lobe-specific expression and apical localization

Abstract

The molecular basis of active ion transport in secretory glands such as the prostate is not well characterized. Rat nongastric H-K-ATPase is expressed at high levels in distal colon surface cell apical membranes and thus is referred to as “colonic.” Here we show that the ATPase is expressed in rodent prostate complex in a lobe-specific manner. RT-PCR and Western blot analyses indicate that rat nongastric H-K-ATPase α-subunit (αng) mRNA and protein are present in coagulating gland (anterior prostate) and lateral and dorsal prostate and absent from ventral lobe, whereas Na-K-ATPase α-subunit is present in all lobes. RT-PCR analysis shows that Na-K-ATPase α4 and α3 and gastric H-K-ATPase α-subunit are not present in significant amounts in all prostate lobes. Relatively low levels of Na-K-ATPase α2were found in lateral, dorsal, and anterior lobes. αngprotein expression is anteriodorsolateral: highest in coagulating gland, somewhat lower in dorsal lobe, and even lower in lateral lobe. Na-K-ATPase protein abundance has the reverse order: expression in ventral lobe is higher than in coagulating gland. αngprotein abundance is higher in coagulating gland than distal colon membranes. Immunohistochemistry shows that in rat and mouse coagulating gland epithelium αng protein has an apical polarization and Na-K-ATPase α1 is localized in basolateral membranes. The presence of nongastric H-K-ATPase in rodent prostate apical membranes may indicate its involvement in potassium concentration regulation in secretions of these glands.

Identification of the β-subunit for nongastric H-K-ATPase in rat anterior prostate

“…Conditions of RT-PCR and primer sequences for tissue expression studies for ␤ 1, ␤2, and ␤3 were essentially as described before (46,48). Primers used for ␤g were GFBE (gcrtctatgtgctgatgcag) and GBBE (gaggaacttgacgatcctgttc).…”

“…Rabbit polyclonal antibodies against ␣ ng have been described before (46). Monoclonal antibody against gastric H-K-ATPase ␤-subunit was purchased from Affinity Bioreagents (Golden, CO).…”

“…Membranes were prepared from rat prostate essentially as described before (46). For deglycosylation, the membranes were incubated for 1 h at 37°C in 0.05 M sodium phosphate, pH 7.4, 0.2% SDS, 2% octyl glucoside, 100 mM dithiothreitol (DTT), 1:50 protease inhibitor cocktail (Sigma), and 5 U/g peptide N-glycosidase F (New England Biolabs).…”

“…A broad screening of tissues has revealed that the gene is also expressed in other tissues, like preputial gland (rat) and placenta (human) (48) and, at the highest level, in rodent prostate (46), especially in the anterior lobe. The cellu-lar location of ␣ ng in prostate epithelium, distal colon, and kidney was shown to be the apical membranes (23, 33,46,49,58).…”

“…In studies reported here, we took advantage of anterior prostate (AP) as the richest source of ␣ ng (46) and have aimed to determine the subunit composition of nongastric H-KATPase through the detailed analysis of the expression of all known X-K-ATPase ␤-subunits in rodent prostate complex. Our findings provide strong evidence that, in rat AP epithelium, X-K-ATPase ␤ 1 -isoform serves as an authentic subunit of nongastric H-K-ATPase, assembling preferentially with ␣ ng , whereas ␤ 3 appears to be selective for Na-K-ATPase ␣-subunit.…”