Novel AluI-polymorphism in the fourth intron of chicken growth hormone gene

Kulibaba, R. O.; Liashenko, Yuriy; Yurko, P. S.

doi:10.3103/s0095452717010091

Cited by 3 publications

(2 citation statements)

References 14 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…The amplifi cation of fragments of the target genes involved the use of the following primers: prolactin gene (C-2402T) -agaggcagcccaggcattttac and cctgggtctggtttggaaattg (Alipanah et al, 2010); growth hormone gene (4 intron, MspI-polymorphism) -ctaaaggacctggaagaaggg and aacttgtcgtaggtgggtctg (Feng et al, 1997); growth hormone gene (4 intron, AluIpolymorphism) -gagggacgtggttatgggcac and gacctcaaggattgcagggct (Kulibaba et al, 2017); insulin-like growth factor I gene (promoter fragment) -cattgcgcaggctctatctg and tcaagagaagcccttcaagc (Khadem et al, 2010); growth hormone receptor gene (2 intron)ggctctccatgggtattagga and gctggtgaaccaatctcggtt (Feng et al, 1997); Mx gene (G2032A, mutation S631N)ccttcagcctgtttttctcctttaggaa and cagaggaatctgattgctcaggcgtgta (Luan et al, 2010).…”

Section: Methodsmentioning

confidence: 99%

Functional genes polymorphism associations with egg quality traits in the populations of dual-purpose

et al. 2020

Self Cite

View full text Add to dashboard Cite

Aim. To study the egg quality traits of Poltava Clay chicken line 14 and Rhode-Island Red chicken line 38 with different genotypes of the prolactin gene (PRL), growth hormone gene (GH), growth hormone receptor gene (GHR), insulin-like growth factor I gene (IGF-I) and Mx gene (Mx). Methods. The study was conducted using the method of polymerase chain reaction and restriction fragment length polymorphism analysis (PCR-RFLP). Results. We found signifi cant differences in line 14 for egg quality between prolactin, growth hormone, growth hormone receptor and Mx loci. Homozygous individuals CC and TT by prolactin locus prevailed over heterozygotes CT for egg weight on the 30th week of life. As for the growth hormone gene, the maximum differences for egg weight were revealed when comparing BC heterozygotes with CC homozygotes. As for the growth hormone receptor gene, signifi cant prevalence (p < 0.05) of individuals with the B0 genotype over A0 by parameters of egg yolk weight was noted at the age of 52 weeks. Signifi cant differences (p < 0.05) in eggshell thickness were determined for genotypes AG and GG by Mx gene in week 52. There were signifi cant differences (p < 0.05) in egg quality traits for prolactin and Mx gene for chickens of line 38. TT homozygotes by prolactin locus are characterized by the prevalence of values (p < 0.05) for the egg, yolk and shell weight. In case of Mx gene polymorphism, the heterozygous individuals were characterized by signifi cantly higher values (p < 0.05) of egg and albumen weight on the 30th week of life. There were no signifi cant differences in both experimental chicken lines for other egg quality traits between individuals with different genotypes. Conclusions. The data obtained are recommended for the use in breeding programs for Poltava Clay chicken line 14 and Rhode-Island Red chicken line 38 with the aim of obtaining microlines with the different genotypes for PRL, GH, GHR and Mx loci.

show abstract

Section: Methodsmentioning

confidence: 99%

Functional genes polymorphism associations with egg quality traits in the populations of dual-purpose

et al. 2020

Self Cite

View full text Add to dashboard Cite

show abstract

“…У другому випадку -за наявністю/відсутністю сайту для HіnfІ у промоторі (Zhou et al, 2005). Поліморфізм у четвертому інтроні гена гормону росту курей (GH) визначали на підставі результатів власних досліджень -за допомогою аналізу наявності/відсутності сайту для AluI (Kulibaba et al, 2017). На відміну від усіх вищеперерахованих, алельні варіанти гена PIT-1 пов'язані не з точковою мутацією (SNP) в сайті рестрикції, а з наявністю/відсутністю інсерції, розміром 57 п. н., у другому інтроні гену (маркер класу Indel) (Nie et al, 2008).…”

Section: матеріал і методи дослідженьunclassified

Association of allele variants of IGF-I, GH and PIT-1 genes with production traits of Birkivska Barvista chicken breed

Kulibaba¹

2017

SMLNUVMBA

View full text Add to dashboard Cite

The article considers the questions about association between allelic variants of insulin-like growth factor I (IGF-I), growth hormone (GH) and pituitary transcription factor-1 (PIT-1) genes with the egg productivity of the Borkovskaya Barvistaya chicken breed. Using classical PCR and PCR-RFLP methods, the PstI-polymorphism in the 5'UTR fragment of the IGF-I gene, HinfI-polymorphism in the promoter fragment of IGF-I gene, AluI-polymorphism in the fourth intron of the GH gene and indel polymorphism in the second intron of the PIT-1 gene were determined. As a result of the studies the significant differences in egg weight values on 30 weeks of life for HinfI-polymorphism in the promoter fragment of the IGF-I gene were revealed. For individuals with the C/C genotype was specific the large values of this index compared to A/A (51,7 ± 0,61 vs. 47.9 ± 0,92 respectively). For PstI-polymorphism in the 5'UTR of the IGF-I gene was shown the prevalence in the number of eggs for 12 weeks of productivity for individuals with the C1C1 genotype compared to C2C2 (65,2 ± 3,77 vs. 60,9 ± 1,33), but in this case the differences are not significantly, what can be caused by a small number of individuals with C1C1 genotype (12). There were no significant differences for other loci.

show abstract