Novel Molecular Mechanism Involving α
            <sub>1D</sub>
            (Cav1.3) L-Type Calcium Channel in Autoimmune-Associated Sinus Bradycardia

Qu, Yongxia; Baroudi, Ghayath; Yue, Yuankun; Boutjdir, Mohamed

doi:10.1161/circulationaha.104.517326

Cited by 69 publications

(90 citation statements)

References 35 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Total cellular RNA was isolated from canine Purkinje tissue using an RNAzol TM B kit [14] as described previously [15,16]. Genomic DNA was removed from all the RNA extract by digestion with DNase.…”

Section: Total Rna Preparationmentioning

confidence: 99%

“…First-strand cDNA was synthesized with reverse transcriptase using total RNA from canine Purkinje tissue with Retroscript kit from Ambion Inc. [15,16]. The primers for Na V 1.4 were selected from the regions that are conserved among different species and unique to Na V 1.4 Primer 5' ccccgagggttatgagtgta, 3' tctcctgatcctcagccagt.…”

Section: Pcr Amplificationmentioning

confidence: 99%

“…Confocal immunostaining was performed as previously reported [15,16,19]. Single Purkinje myocytes were plated on laminin-coated glass coverslips and fixed with 4% paraformaldehyde for 30 min followed by permeabilization with 0.1% Triton X-100 for 15 min.…”

Section: Immunostainingmentioning

confidence: 99%

See 2 more Smart Citations

Expression of skeletal muscle NaV1.4 Na channel isoform in canine cardiac Purkinje myocytes

Karnabi

Chahine

et al. 2007

Biochemical and Biophysical Research Communications

Self Cite

View full text Add to dashboard Cite

Background and Aim-The action potential plateau of Purkinje fibers is particularly sensitive to tetrodotoxin (TTX) and this could be due to a TXX-sensitive Na + current. The expression of TTXsensitive neuronal Na V 1.1 and Na V 1.2 isoforms has been reported in canine Purkinje myocytes. Our aim was to investigate by means of biochemical and functional techniques whether the TTX-sensitive skeletal Na V 1.4 isoform is also expressed in canine cardiac Purkinje myocytes.

show abstract

Section: Total Rna Preparationmentioning

confidence: 99%

Section: Pcr Amplificationmentioning

confidence: 99%

See 1 more Smart Citation

Expression of skeletal muscle NaV1.4 Na channel isoform in canine cardiac Purkinje myocytes

Karnabi

Chahine

et al. 2007

Biochemical and Biophysical Research Communications

Self Cite

View full text Add to dashboard Cite

show abstract

“…Mutation in ankyrin-B causes SSS by reduced membrane targeting of Ca v 1.3 channels (11). The relevance of Ca v 1.3 channels to SSS is demonstrated also by work on the pathophysiology of congenital heart block, where down-regulation of Ca v 1.3 channels by maternal Abs causes heart block in infants (12). Additionally, recent data show that chronic iron overload induces acquired SSS via a reduction in Ca v 1.3-mediated I Ca,L (13).…”

mentioning

confidence: 99%

G protein-gated I _KACh channels as therapeutic targets for treatment of sick sinus syndrome and heart block

Mesirca

Bidaud

Briec

et al. 2016

Proc. Natl. Acad. Sci. U.S.A.

View full text Add to dashboard Cite

Dysfunction of pacemaker activity in the sinoatrial node (SAN) underlies “sick sinus” syndrome (SSS), a common clinical condition characterized by abnormally low heart rate (bradycardia). If untreated, SSS carries potentially life-threatening symptoms, such as syncope and end-stage organ hypoperfusion. The only currently available therapy for SSS consists of electronic pacemaker implantation. Mice lacking L-type Cav1.3 Ca2+ channels (Cav1.3−/−) recapitulate several symptoms of SSS in humans, including bradycardia and atrioventricular (AV) dysfunction (heart block). Here, we tested whether genetic ablation or pharmacological inhibition of the muscarinic-gated K+ channel (IKACh) could rescue SSS and heart block in Cav1.3−/− mice. We found that genetic inactivation of IKACh abolished SSS symptoms in Cav1.3−/− mice without reducing the relative degree of heart rate regulation. Rescuing of SAN and AV dysfunction could be obtained also by pharmacological inhibition of IKACh either in Cav1.3−/− mice or following selective inhibition of Cav1.3-mediated L-type Ca2+ (ICa,L) current in vivo. Ablation of IKACh prevented dysfunction of SAN pacemaker activity by allowing net inward current to flow during the diastolic depolarization phase under cholinergic activation. Our data suggest that patients affected by SSS and heart block may benefit from IKACh suppression achieved by gene therapy or selective pharmacological inhibition.

show abstract

“…The evidence presented suggests a critical role of the ␣ 1D Ca 2ϩ channel in diastolic depolarization and in the rate of discharge of the sinoatrial (SA) node. The expression of ␣ 1D Ca 2ϩ channel was demonstrated in the SA node, AV node, and atria, but not in the ventricles of adult hearts (15,20,26). Therefore, deletion of ␣ 1D Ca 2ϩ channel could play an important role in altering the normal activity of the atrium and might also contribute to atrial arrhythmias, such as atrial fibrillation (AF).…”

mentioning

confidence: 99%

Impaired Ca²⁺ homeostasis is associated with atrial fibrillation in the α_1D L-type Ca²⁺ channel KO mouse

Mancarella¹,

Yue²,

Karnabi³

et al. 2008

American Journal of Physiology-Heart and Circulatory Physiology

Self Cite

View full text Add to dashboard Cite

current (ICa-L) in the mouse supraventricular tissue. However, its functional role in the heart is just emerging. We used the ␣1D gene knockout (KO) mouse to investigate the electrophysiological features, the relative contribution of the ␣ 1D Ca 2ϩ channel to the global ICa-L, the intracellular Ca 2ϩ transient, the Ca 2ϩ handling by the sarcoplasmic reticulum (SR), and the inducibility of atrial fibrillation (AF). In vivo and ex vivo ECG recordings from ␣1D KO mice demonstrated significant sinus bradycardia, atrioventricular block, and vulnerability to AF. The wild-type mice showed no ECG abnormalities and no AF. Patch-clamp recordings from isolated ␣1D KO atrial myocytes revealed a significant reduction of ICa-L (24.5%; P Ͻ 0.05). However, there were no changes in other currents such as INa, ICa-T, IK, If, and Ito and no changes in ␣1C mRNA levels of ␣1D KO atria. Fura 2-loaded atrial myocytes showed reduced intracellular Ca 2ϩ transient (ϳ40%; P Ͻ 0.05) and rapid caffeine application caused a 17% reduction of the SR Ca 2ϩ content (P Ͻ 0.05) and a 28% reduction (P Ͻ 0.05) of fractional SR Ca 2ϩ release in ␣1D KO atria. In conclusion, genetic deletion of ␣1D Ca 2ϩ channel in mice results in atrial electrocardiographic abnormalities and AF vulnerability. The electrical abnormalities in the ␣1D KO mice were associated with a decrease in the total ICa-L density, a reduction in intracellular Ca 2ϩ transient, and impaired intracellular Ca 2ϩ handling. These findings provide new insights into the mechanism leading to atrial electrical dysfunction in the ␣1D KO mice. mice; calcium transient; arrhythmia; myocyte THE VOLTAGE-GATED ␣ 1D Ca 2ϩ channel was previously considered to be expressed only in cells of neuroendocrine origin (10). Recent studies (11,15,16,19,26) reported that the ␣ 1D deletion in mice causes sinus bradycardia and various degrees of atrioventricular (AV) block. The evidence presented suggests a critical role of the ␣ 1D Ca 2ϩ channel in diastolic depolarization and in the rate of discharge of the sinoatrial (SA) node. The expression of ␣ 1D Ca 2ϩ channel was demonstrated in the SA node, AV node, and atria, but not in the ventricles of adult hearts (15,20,26). Therefore, deletion of ␣ 1D Ca 2ϩ channel could play an important role in altering the normal activity of the atrium and might also contribute to atrial arrhythmias, such as atrial fibrillation (AF).AF is the most common cardiac arrhythmia, and it is associated with a four-to fivefold increase in the risk of stroke compared with the general population. It affects an estimated 2.2 million adults in the United States (4). Because of its clinical relevance and the lack of an effective therapy, many experimental models of AF have been tested to elucidate the mechanisms of initiation and maintenance of AF. A decreased L-type Ca 2ϩ current (I Ca-L ) density is a common finding and has been reported in several models of AF (23,25).Unlike ventricular cells, a unique property of atrial cells is that both ␣ 1C and ␣ 1D Ca 2ϩ channels contribute to the tota...

show abstract

Novel Molecular Mechanism Involving α _1D (Cav1.3) L-Type Calcium Channel in Autoimmune-Associated Sinus Bradycardia

Cited by 69 publications

References 35 publications

Expression of skeletal muscle NaV1.4 Na channel isoform in canine cardiac Purkinje myocytes

Expression of skeletal muscle NaV1.4 Na channel isoform in canine cardiac Purkinje myocytes

G protein-gated I _KACh channels as therapeutic targets for treatment of sick sinus syndrome and heart block

Impaired Ca²⁺ homeostasis is associated with atrial fibrillation in the α_1D L-type Ca²⁺ channel KO mouse

Contact Info

Product

Resources

About

Novel Molecular Mechanism Involving α 1D (Cav1.3) L-Type Calcium Channel in Autoimmune-Associated Sinus Bradycardia

Cited by 69 publications

References 35 publications

Expression of skeletal muscle NaV1.4 Na channel isoform in canine cardiac Purkinje myocytes

Expression of skeletal muscle NaV1.4 Na channel isoform in canine cardiac Purkinje myocytes

G protein-gated I KACh channels as therapeutic targets for treatment of sick sinus syndrome and heart block

Impaired Ca2+ homeostasis is associated with atrial fibrillation in the α1D L-type Ca2+ channel KO mouse

Contact Info

Product

Resources

About

Novel Molecular Mechanism Involving α _1D (Cav1.3) L-Type Calcium Channel in Autoimmune-Associated Sinus Bradycardia

G protein-gated I _KACh channels as therapeutic targets for treatment of sick sinus syndrome and heart block

Impaired Ca²⁺ homeostasis is associated with atrial fibrillation in the α_1D L-type Ca²⁺ channel KO mouse