Novel PSI Domains in Plant and Animal H+-Inositol Symporters

Abstract

Uptake of carbohydrates across plasma membranes of animal cells is mediated mainly by Na + -driven transporters, such as the sodium-dependent glucose transporter(SGLT) (1) or the sodium-myo-inositol co-transporter (SMIT) (2). In contrast, animal monosaccharide transporters of the GLUT family (GLUT1 to GLUT12) are energy-independent (1). One protein of this family, however, GLUT13, acts as energy-dependent H + -inositol symporter (HMIT) (3). All 13 GLUT proteins are closely related to H + -dependent sugar transporters from bacteria and plants (4). Plants do not have SGLT-like or SMIT-like proteins. They rather catalyze the transport of inositol with several HMIT-like H + -symporters [three in Arabidopsis thaliana: AtINT1, AtINT2 and AtINT4 (5-7)] that localize either to the plasma membrane (AtINT2 and AtINT4) or to the tonoplast (AtINT1).Inositols have multiple and partly different metabolic functions in plants and animals, and in both kingdoms, inositol derivatives are central for cellular signaling (8-10). Altered cytoplasmic inositol concentrations might, therefore, affect the general metabolism as well as specific signaling pathways. In the brains of patients suffering from depression or bipolar disorders, increased inositol concentrations are thought to affect cellular signaling and behavior (11). As neurons cannot synthesize inositol (12,13), increased neuronal inositol concentrations might be explained by altered HMIT-catalyzed inositol uptake (13). Similarly, in plants, a defect in a single inositol transporter causes severe developmental defects (7).Obviously, cytoplasmic inositol concentrations are regulated. The rapid cycling between intracellular vesicles and the cell surface described for the HMIT protein in rat (Rattus norvegicus) neurons (13) demonstrates the tight control of inositol uptake. Moreover, since more than 50 years, treatments of mood disorders rely on drugs (Li + salts, valproic acid, etc.) known to reduce cellular inositol concentrations by inhibiting enzymes involved in the recycling of inositol (11).Inositol uptake might also be regulated by extracellular factors or changing environmental conditions. Interestingly, all animal and plant plasma-membrane H + -inositol symporters (but not the H + -inositol symporters from bacteria, fungi or plant endomembranes) carry a large extracellular loop domain between their predicted transmembrane helices IX and X (IX/X-loop). This domain contains eight highly conserved cysteines, four as CXXC motifs (CXXC, two cysteines separated by two other amino acids), but information on the function of this domain is lacking.Here, we present in-depth analyses of the IX/X-loop domains of plasma-membrane inositol transporters from plants and animals. Comparative studies performed with the human HMIT protein (hHMIT) and the A. thaliana INT2 protein (AtINT2) revealed that their IX/X-loops share sequence and structural similarity with plexin/semaphorin/ integrin (PSI) domains previously found in the extracellular regions of animal type I receptors including the ...

Routes to the Tonoplast: The Sorting of Tonoplast Transporters in Arabidopsis Mesophyll Protoplasts

“…They are absent from the tonoplastlocalized plant paralogs. Removal of the PSI domain neither affected the transport activity nor the sorting to the plasma membrane (Dotzauer et al, 2010).…”

“…Insertion into the vector pCS120 (Dotzauer et al, 2010) All chimera, truncations, and mutations of INT1 and INT4 contain flanking NcoI or PciI cloning sites for insertion into the expression vectors. For GFP fusion constructs, the above-described constructs were excised from pJET1.2 with NcoI or PciI and inserted into the unique NcoI cloning sites of pCS120 (Dotzauer et al, 2010) for C-terminal GFP fusions or pSS87 for N-terminal GFP fusions.…”

Evidence for an unusual transmembrane configuration of AGG3, a class C Gγ subunit of Arabidopsis

“…The full‐length coding sequence of RGS1 was amplified using primers RGS1–5‐NcoI (5′‐CCATGGCGAGTGGATGTGCTCTACATGGTGGTTG‐3′) and RGS1–3‐NcoI (5′‐CCATGGCACCGGGACTACTGCATCTGGAACTCTTTGAC‐3′). The resulting sequences were then cloned into protoplast expression vector pCS120 for C–terminal GFP fusions (Dotzauer et al ., ) or protoplast expression vector pSS87 for N–terminal GFP fusions (Schneider et al ., ). As a PM marker for co‐localization studies, we used the myo ‐inositol transporter AtINT4 (At4g16480) C–terminally fused to RFP (Wolfenstetter et al ., ).…”

Inositol transport proteins

“…Conserved cysteins within the enlarged extracellular loop that are responsible for formation of the PSI domain are highlighted in orange. Protein structures modified after Dotzauer et al [22].…”