Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi

Abstract

Six DNA regions were evaluated as potential DNA barcodes for Fungi, the second largest kingdom of eukaryotic life, by a multinational, multilaboratory consortium. The region of the mitochondrial cytochrome c oxidase subunit 1 used as the animal barcode was excluded as a potential marker, because it is difficult to amplify in fungi, often includes large introns, and can be insufficiently variable. Three subunits from the nuclear ribosomal RNA cistron were compared together with regions of three representative proteincoding genes (largest subunit of RNA polymerase II, second largest subunit of RNA polymerase II, and minichromosome maintenance protein). Although the protein-coding gene regions often had a higher percent of correct identification compared with ribosomal markers, low PCR amplification and sequencing success eliminated them as candidates for a universal fungal barcode. Among the regions of the ribosomal cistron, the internal transcribed spacer (ITS) region has the highest probability of successful identification for the broadest range of fungi, with the most clearly defined barcode gap between inter-and intraspecific variation. The nuclear ribosomal large subunit, a popular phylogenetic marker in certain groups, had superior species resolution in some taxonomic groups, such as the early diverging lineages and the ascomycete yeasts, but was otherwise slightly inferior to the ITS. The nuclear ribosomal small subunit has poor species-level resolution in fungi. ITS will be formally proposed for adoption as the primary fungal barcode marker to the Consortium for the Barcode of Life, with the possibility that supplementary barcodes may be developed for particular narrowly circumscribed taxonomic groups.DNA barcoding | fungal biodiversity T he absence of a universally accepted DNA barcode for Fungi, the second most speciose eukaryotic kingdom (1, 2), is a serious limitation for multitaxon ecological and biodiversity studies. DNA barcoding uses standardized 500-to 800-bp sequences to identify species of all eukaryotic kingdoms using primers that are applicable for the broadest possible taxonomic group. Reference barcodes must be derived from expertly identified vouchers deposited in biological collections with online metadata and validated by available online sequence chromatograms. Interspecific variation should exceed intraspecific variation (the barcode gap), and barcoding is optimal when a sequence is constant and unique to one species (3, 4). Ideally, the barcode locus would be the same for all kingdoms. A region of the mitochondrial gene encoding the cytochrome c oxidase subunit 1 (CO1) is the barcode for animals (3, 4) and the default marker adopted by the Consortium for the Barcode of Life for all groups of organisms, including fungi (5). In Oomycota, part of the kingdom Stramenopila historically studied by mycologists, the de facto barcode internal transcribed spacer (ITS) region is suitable for identification, but the default CO1 marker is more reliable in a few clades of closely related species (6)...

Phylogenetic congruence between subtropical trees and their associated fungi

“…Using high‐throughput sequencing, thousands of sequences can be analyzed from a single environmental sample, enabling researchers to undertake an in‐depth analysis of fungal diversity (Bellemain et al., 2010). However, we realize that although ITS combines the highest resolving power for discriminating closely related species and has a high sequencing success rate across a broad range of fungi (Schoch et al., 2012), it has some methodological limitations as functionally distinct fungi (e.g., pathogenic vs. mutualistic species) may have nearly identical ITS sequences. The species‐level identification of plant–fungus associations is also limited by incomplete databases of fungal diversity.…”

“…We extracted total genomic DNA directly from each sample according to a standard procedure. The nuclear ribosomal ITS region (including ITS1, 5.8S rRNA,and ITS2), an approximately 600‐base‐pair region frequently used in species‐level systematics for fungi, was chosen as the target gene because it has been proposed as the standard barcode for fungi and has the highest probability of successful identification for the broadest range of fungi, with the most clearly defined barcode gap between inter‐ and intraspecific variations (Schoch et al., 2012). The ITS gene was amplified by polymerase chain reactions (PCRs) using the fungal primer set of ITS1 (5′‐ NNNNNNNNNN TCCGTAGGTGAACCTGCGG‐3′) and ITS4 (5′‐TCCTCCGCTTATTGATATGC‐3′) (White, Bruns, Lee, & Taylor, 1990), where NNNNNNNNNN represents the 10‐bp barcode designed for sample identification and the ITS primers were fused with the 454 pyrosequencing adapters.…”

Morphologic and molecular description of Metopus fuscus Kahl from North America and new rDNA sequences from seven metopids (Armophorea, Metopidae)

“…/j.ejop.2014 amitochondriate armophorids but alternatives (e.g. 18S rDNA and ITS) may suffice for this purpose (Schoch et al 2012). NOTICE: this is the author's version of a work that was accepted for publication in European Journal of Protistology.…”

The rise of Ramularia from the Mycosphaerella labyrinth

“…Identification of closely related species based on morphology is often difficult and the ITS barcode of fungi alone (Schoch et al 2012) is unreliable for species identification among several cercosporoid genera (e.g. Groenewald et al, 2013and Bakhshi et al, 2015.…”