Nucleo‐cytoplasmic cycling of the vitamin D receptor in the enterocyte‐like cell line, Caco‐2

Kłopot, Anna; Hance, Kenneth W.; Peleg, Sara; Bársony, Julia; Fleet, James C.

doi:10.1002/jcb.21087

Cited by 28 publications

(22 citation statements)

References 40 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…We [26,27] and others [28,29], showed that nuclear accumulation of VDR is directly related to biological activity of 1,25D analogs. Given that VDR nuclear accumulation and pro-differentiating activity were correlated for previously tested analogs [27], we now studied how vitamin D 2 analogs influence expression of VDR in HL60 cells.…”

Section: Expression Of Vdr and C/ebpˇin Cells Exposed To 125d And Anmentioning

confidence: 95%

Structure–function analysis of vitamin D2 analogs as potential inducers of leukemia differentiation and inhibitors of prostate cancer proliferation

Baurska

Kłopot

Kiełbiński

et al. 2011

The Journal of Steroid Biochemistry and Molecular Biology

View full text Add to dashboard Cite

Section: Expression Of Vdr and C/ebpˇin Cells Exposed To 125d And Anmentioning

confidence: 95%

Structure–function analysis of vitamin D2 analogs as potential inducers of leukemia differentiation and inhibitors of prostate cancer proliferation

Baurska

Kłopot

Kiełbiński

et al. 2011

The Journal of Steroid Biochemistry and Molecular Biology

View full text Add to dashboard Cite

“…RNA was isolated using TriReagent following the manufacturer's instructions (Molecular Research Center Inc., Cincinnati, OH). Total RNA (2 µg) was reverse transcribed to make cDNA and analyzed by real‐time PCR using primers and conditions previously described by our group [Wang et al, 2004; Klopot et al, 2006].…”

Section: Methodsmentioning

confidence: 99%

CXC chemokine receptor-1 is expressed by hepatocytes and regulates liver recovery after hepatic ischemia/reperfusion injury

et al. 2011

View full text Add to dashboard Cite

CXC chemokines mediate hepatic inflammation and injury following ischemia/reperfusion (I/ R). More recently, signaling through CXC chemokine receptor-2 (CXCR2) was shown to delay liver recovery and repair after I/R injury. The chemokine receptor CXCR1 shares ligands with CXCR2, yet nothing is known about its potential role in liver pathology. In the present study, we examined the role of CXCR1 in the injury and recovery responses to I/R using a murine model. CXCR1 expression was undetectable in livers of sham-operated mice. However, after ischemia CXCR1 expression increased 24 hours after reperfusion and was maximal after 96 hours of reperfusion. CXCR1 expression was localized largely to hepatocytes. In order to assess the function of CXCR1, CXCR22/2 mice were treated with the CXCR1/CXCR2 antagonist, repertaxin. Prophylactic treatment with repertaxin had no effect on acute inflammation or liver injury. However, when repertaxin was administered 24 hours postreperfusion there was a significant increase in hepatocellular injury and a delay in recovery compared to control-treated mice. CXCR12/2 mice also demonstrated delayed recovery and regeneration after I/R when compared to wild-type mice. In vitro, hepatocytes from CXCR2 2/2 mice that were stimulated to express CXCR1 showed increased proliferation in response to ligand. Hepatocyte proliferation was decreased in CXCR1 2/2 mice in vivo. Conclusion: This is the first report to show that CXCR1 expression is induced in hepatocytes after injury. Furthermore, the data suggest that CXCR1 has divergent effects from CXCR2 and appears to facilitate repair and regenerative responses after I/R injury. (HEPATOLOGY 2011;53:261-271) I schemia/reperfusion (I/R) of the liver often occurs as a result of liver resection surgery, transplantation, and trauma, and is a primary cause of subsequent liver dysfunction.1-3 The recovery and regeneration of the liver after I/R is associated with the temporal expression of cell cycle control proteins. 4 Recent data from our laboratory has demonstrated that this process is regulated by signaling through CXC chemokine receptor-2 (CXCR2). 5 These studies demonstrated that deletion or pharmacological blockade of CXCR2 increased hepatocyte proliferation and liver regeneration in association with increased activation of the transcription factors, nuclear factor-jB (NF-jB) and signal transducer and activator of transcription-3 (STAT3). Furthermore, we showed that ligands of CXCR2 have direct, dose-dependent effects on hepatocytes to regulate cell death or proliferation. 5The ligands for CXCR2 are comprised of a subclass of CXC chemokines which possess the amino acid sequence Glu-Leu-Arg (ELR motif ) in the amino terminus.6,7 However, CXCR2 is not the only receptor for ELR þ CXC chemokines. In humans, CXC chemokine receptor-1 (CXCR1) also binds many of these ligands and has both overlapping and independent Abbreviations: ALT, alanine amino transferase; BrdU, 5-bromo-2 0 -deoxyuridine; CXCR1, CXC chemokine receptor-1; CXCR2, CXC chemokine receptor-...

show abstract

“…For all genes studied, mRNA expression was normalized to GAPDH mRNA expression, and data were expressed as arbitrary units. The primers used for CYP24 and GAPDH (Klopot et al, 2007), for VDR (Lou et al, 2005), and for Ets-1, ESE-1 and ESE-3 were previously described (Hollenhorst et al, 2004). Primers used for TRPV6 are: Forward primer: TTCCTGCGGGTGGAAGACAGGCA; Reverse primer: ACGCAGGTCTCTCCTCAGGGTC CC.…”

Section: Methodsmentioning

confidence: 99%

Effects of MAPK signaling on 1,25‐dihydroxyvitamin D‐mediated CYP24 gene expression in the enterocyte‐like cell line, Caco‐2

Cui

Zhao

Hance

et al. 2008

Journal Cellular Physiology

Self Cite

View full text Add to dashboard Cite

We examined the role of the Extracellular signal Regulated Kinases (ERK) in 1,25 dihydroxyvitamin D (1,25(OH) 2 D 3 )-induced gene expression in the differentiated Caco-2 cells. 1,25(OH) 2 D 3 -regulated expression of the 25-hydroxyvitamin D, 24 hydroxylase (CYP24) gene (both natural gene and promoter construct) was strongly modulated by altering ERK activity (i.e. reduced by MEK inhibitors and dominant negative (dn) ERK1 and ERK2, activated by Epidermal Growth Factor) but ERK inhibition had no effect on 1,25(OH) 2 D 3 -regulated expression of the transient receptor potential cation channel, subfamily V, member 6 (TRPV6). ERK5-mediated phosphorylation of the transcription factor Ets-1 enhanced 1,25(OH) 2 D 3 -mediated CYP24 gene transcription in proliferating but not differentiated Caco-2 cells due to reduced levels of ERK5 and Ets-1 (total and phospho-protein levels) in differentiated cells. MEK inhibition reduced 1,25(OH) 2 D 3 -induced 3X-VDRE promoter activity but had no impact on the association of vitamin D receptor (VDR) with chromatin suggesting a role for co-activator recruitment in ERKmodulation of vitamin D-regulated CYP24 gene activation. Chromatin immunoprecipitation assays revealed that the ERK1/2 target, mediator 1 (MED1), is recruited to the CYP24, but not the TRPV6, promoter following 1,25(OH) 2 D 3 treatment. MED1 phosphorylation was sensitive to activators and inhibitors of the ERK1/2 signaling and MED1 siRNA reduced 1,25(OH) 2 D 3 -regulated human CYP24 promoter activity. This suggests ERK1/2 signaling enhances 1,25(OH) 2 D 3 effects on the CYP24 promoter by MED1-mediated events. Our data show that there are both promoter-specific and cell stage-specific roles for the ERK signaling pathway on 1,25(OH) 2 D 3 -mediated gene induction in enterocyte-like Caco-2 cells.

show abstract

Nucleo‐cytoplasmic cycling of the vitamin D receptor in the enterocyte‐like cell line, Caco‐2

Cited by 28 publications

References 40 publications

Structure–function analysis of vitamin D2 analogs as potential inducers of leukemia differentiation and inhibitors of prostate cancer proliferation

Structure–function analysis of vitamin D2 analogs as potential inducers of leukemia differentiation and inhibitors of prostate cancer proliferation

CXC chemokine receptor-1 is expressed by hepatocytes and regulates liver recovery after hepatic ischemia/reperfusion injury

Effects of MAPK signaling on 1,25‐dihydroxyvitamin D‐mediated CYP24 gene expression in the enterocyte‐like cell line, Caco‐2

Contact Info

Product

Resources

About