Nucleotide sequence comparison of normal and translocated murine c-myc genes

Stanton, Lawrence W.; Fahrlander, Paul D.; Tesser, Paul; Marcu, Kenneth B.

doi:10.1038/310423a0

Cited by 148 publications

(82 citation statements)

References 29 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Hybridizations of Southern and Northern blots were carried out according to (Church et al, 1984), using probes labeled by random priming. The following probes were used: cloned WHV DNA (Ogston et al, 1982), a 1.4 kb BglII fragment speci®c for woodchuck c-myc exon 1 (MoÈ roÈ y et al, 1985), a murine c-myc exon 1 probe (Stanton et al, 1984), a PCR fragment spanning 420 bp of the HBVayw X open reading frame (positions 1375 ± 1795 on the HBV map) (Galibert et al, 1979), and a mouse actin cDNA. After hybridization with the c-myc probes, ®lters were washed under conditions of high stringency (0.16SSC, 0.1% SDS, 658C for 1 h).…”

Section: Dna and Rna Analysismentioning

confidence: 99%

The hepatitis B virus X gene potentiates c-myc-induced liver oncogenesis in transgenic mice

et al. 1997

View full text Add to dashboard Cite

The hepatitis B virus X protein (HBx) is thought to be implicated in the development of hepatocellular carcinoma, but its exact function remains controversial. Transgenic mice from PEX7 and AX16 lineages that express HBx in the liver under control of di erent viral regulatory elements develop no liver pathology (Billet et al., 1995). We have crossed these two mouse lineages with WHV/c-myc oncomice in which liver-speci®c expression of c-myc driven by woodchuck hepatitis virus (WHV) regulatory sequences causes liver cancer in all animals. The average tumor latency was shortened by 2 to 3 months in bitransgenic animals from all populations compared with simple c-myc transgenic littermates. At preneoplastic stages, adult bitransgenic mice showed four to ®vefold enhanced expression of the c-myc transgene, increased hepatocyte proliferation and more extensive liver lesions compared with simple WHV/c-myc transgenics. Thus in this model, HBx alone has no direct pathological e ect but it is shown to accelerate tumor development induced by c-myc. The data presented here ®rmly establish the oncogenic potential of HBx, apparently acting as a tumor promoter. This model o ers unique opportunities to investigate the mechanisms by which HBx trans-activates the expression of target genes and deregulates the hepatocyte growth control in vivo.

show abstract

Section: Dna and Rna Analysismentioning

confidence: 99%

The hepatitis B virus X gene potentiates c-myc-induced liver oncogenesis in transgenic mice

et al. 1997

View full text Add to dashboard Cite

show abstract

“…A mouse c-myc cDNA probe was obtained using 5'-d(GTGCTCCAGCCCCAGGTCCT)-3' as a 5'-primer and 5'-d(GTTTATGCACCAGAGTTTCG)-3' as a 3'-primer. The ampli®ed fragment corresponds to nucleotides 1629 ± 1928 of the published cDNA sequence (Stanton et al, 1984;accession number: X01023). A human c-myc cDNA probe was obtained using 5'-d(ATGCACCAGCCCCAGGTCCT)-3' as a 5'-primer and 5'-d(CCTTACGCACAAGAGTTCCG)-3' as a 3'-primer.…”

Section: Cdna Templatesmentioning

confidence: 99%

The Mad1 transcription factor is a novel target of activin and TGF-β action in keratinocytes: possible role of Mad1 in wound repair and psoriasis

et al. 2001

View full text Add to dashboard Cite

Activin A, a member of the transforming growth factor beta (TGF-b) superfamily, a ects keratinocyte proliferation and di erentiation in vitro and in vivo. However, little is known about the mechanisms of activin action in keratinocytes, and its target genes have not been identi®ed. In this study, we demonstrate that activin A and TGF-b1 directly induce the expression and activity of Mad1, an antagonist of the c-Myc transcription factor, in the human HaCaT keratinocyte cell line. Expression and activity of Mad1 was strongly induced by both factors in keratinocytes, although the intensity of induction was di erent for activin A and TGF-b1. To determine a possible role of activin and TGF-b in the regulation of mad1 expression in vivo, we analysed its expression during cutaneous wound repair when high levels of these factors are present. Expression of mad1 mRNA and protein, but not of other mad genes, increased signi®cantly after skin injury, particularly in polymorphonuclear leukocytes and in suprabasal keratinocytes of the hyperproliferative epithelium. Elevated levels of mad1 mRNA were also detected in the hyperthickened epidermis of psoriatic patients. Since Mad1 regulates proliferation and/or di erentiation of various cell types, our results suggest that this transcription factor mediates at least in the part the anti-mitotic and/or di erentiation-inducing activities of TGF-b and activin in keratinocytes. Oncogene (2001) 20, 7494 ± 7504.

show abstract

“…36), MAX(L), and MAX(S) (16) were excised from their parental vectors and cloned into the XhoI site of the pSVLneo vector. This was derived from the pSVL vector (Pharmacia) by inserting into the unique EcoRI site a 2.5-kilobase EcoRI-linkered DNA fragment containing the neomycin resistance gene under the control of the SV40 early promoter (37).…”

Section: Expression and Purification Of Recombinant Proteins-max Cdnasmentioning

confidence: 99%

Distinct Roles for MAX Protein Isoforms in Proliferation and Apoptosis

Zhang¹,

Fan²,

Prochownik³

1997

Journal of Biological Chemistry

105

View full text Add to dashboard Cite

MAX is a basic helix-loop-helix-leucine zipper protein that plays a central role in the transcriptional control of Myc oncoproteins. MYC-MAX heterodimers stimulate transcription, whereas MAX homodimers, or heterodimers between MAX and members of the MAD family of basic helix-loop-helix-leucine zipper proteins, repress transcription. Max exists in two major isomeric forms, MAX(L) and MAX(S), which differ from one another only by a 9-amino acid insertion/deletion. We show here that MAX(L) is much more effective at homodimeric DNA binding than MAX(S). In NIH3T3 cells, MAX(L) was able to repress a c-Myc-responsive reporter gene whereas MAX(S) either stimulated the reporter gene or had little effect on its expression. In comparison to control cell lines or those stably over-expressing MAX(S), MAX(L)-over-expressing cell lines showed reduced expression of transiently expressed or endogenous c-Myc responsive genes, grew more slowly, possessed a higher growth factor requirement, and showed accelerated apoptosis following growth factor deprivation. Differential effects on growth and apoptosis represent two previously unrecognized properties of MAX proteins. These can at least partly be explained by the differences in their DNA binding abilities and their effects on target gene expression.

show abstract

Nucleotide sequence comparison of normal and translocated murine c-myc genes

Cited by 148 publications

References 29 publications

The hepatitis B virus X gene potentiates c-myc-induced liver oncogenesis in transgenic mice

The hepatitis B virus X gene potentiates c-myc-induced liver oncogenesis in transgenic mice

The Mad1 transcription factor is a novel target of activin and TGF-β action in keratinocytes: possible role of Mad1 in wound repair and psoriasis

Distinct Roles for MAX Protein Isoforms in Proliferation and Apoptosis

Contact Info

Product

Resources

About