Occurrence of Sheraphelenchus sucus (Nematoda: Aphelenchoidinae) and Panagrellus sp. (Rhabditida: Panagrolaimidae) Associated with Decaying Pomegranate Fruit in Italy

Abstract

Two different nematode species were recovered from pomegranate decaying fruit in two localities in Southern Italy: the mycetophagus nematode Sheraphelenchus sucus and a bacterial feeder nematode belonging to the Panagrolaimidae (Rhabditida) family. Morphometrics of the Italian population of S. sucus closely resemble that of the type population, whereas some differences were found when compared with another population from Iran. Molecular characterization of the Italian S. sucus using the 18S rRNA gene, D2-D3 expansion domains of the 28S rDNA, the ITS region, and the partial mitochondrial COI were carried out. Sequences of the 18S rRNA gene, the D2-D3 domains, and the ITS were analyzed using several methods for inferring phylogeny to reconstruct the relationships among Sheraphelenchus and Bursaphelenchus species. The bacterial feeder Panagrellus sp. was characterized at the molecular level only. The D2-D3 expansion domains and ITS sequences of this Italian panagrolaimid were determined. The D2-D3 sequences of the Italian panagrolaimid showed 99% similarity with the corresponding sequence of Panagrellus sp. associated with Rhynchophorus ferrugineus. This is the first report on the tritrophic association of S. sucus and Rhabditida that uses both insects and pomegranate fruit as hosts.

Pristionchus nematodes occur frequently in diverse rotting vegetal substrates and are not exclusively necromenic, while Panagrellus redivivoides is found specifically in rotting fruits

“…The large subunit (LSU, 28S) of ribosomal DNA of Panagrellus isolates was amplified using primers D2A ( ) and D3B ( ) as in [ 53 ].…”

Molecular profiling of nematode associates with Rhynchophorus ferrugineus in southern Italy

“…The sequence of the D2‐D3 expansion domains of the rhabditids showed a 100% similarity with Panagrellus sp. recovered from R. ferrugineus in Tuscany, and from decaying pomegranate in association with the nematode Sheraphelenchus sucus in Apulia (Camerota et al, ; Fanelli et al, ).…”

“…Apart from the two phoretic nematode species found in this study, other nematode species were also occasionally associated with R. ferrugineus. Of these, Oscheius tipulae (Lam & Webster, 1971), Sudhaus, 1993 (Camerota et al, 2016;Fanelli et al, 2017).…”

Pristionchusnematodes occur frequently in diverse rotting vegetal substrates and are not exclusively necromenic, whilePanagrellus redivivoidesis found specifically in rotting fruits

“…Its 28S rDNA sequence is identical to that of a Panagrellus sp. found in decomposing pomegranate in Italy [53] and both 28S and 18S sequences are similar but not identical to that of a Panagrellus found in a weevil in [61]. A new species of Panagrellus has been very recently described from a culture of Drosophila melanogaster and called P. levitatus [62].…”

“…The large subunit (LSU, 28S) of ribosomal DNA of Panagrellus isolates was amplified using primers D2A (ACAAGTACCGTGGGGAAAGTTG) and D3B (TCGGAAGGAACCAGCTACTA) as in [53].…”