Oligodeoxynucleotides containing CpG motifs can induce T cell–dependent arthritis in rats

Svelander, L.; Harris, Helena Erlandsson; Lorentzen, Johnny C.; Trollmo, Christina; Klareskog, Lars; Bucht, Anders

doi:10.1002/art.11488

Cited by 20 publications

(14 citation statements)

References 31 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…In this arthritis model, TLR4-deficient mice register delayed disease progression and decreased production of the proinflammatory mediators TNF-␣ and cyclooxygenase-2 in the synovial tissue, compared with wild-type animals. Immune responses provoked by bacterial DNA and CpG have been implicated in the onset of a Th1 cell-dependent and IL-1/IFN-␥-mediated joint-specific inflammation in LEW and LEW.1AV1 rat strains (47). In addition, numerous studies have shown expression of TLR4 and TLR2 in RA synovium (46,48).…”

Section: Discussionmentioning

confidence: 99%

Essential Role of MAPK Phosphatase-1 in the Negative Control of Innate Immune Responses

Salojin

Owusu

Millerchip

et al. 2006

The Journal of Immunology

311

286

View full text Add to dashboard Cite

TLR-induced innate immunity and inflammation are mediated by signaling cascades leading to activation of the MAPK family of Ser/Thr protein kinases, including p38 MAPK, which controls cytokine release during innate and adoptive immune responses. Failure to terminate such inflammatory reactions may lead to detrimental systemic effects, including septic shock and autoimmunity. In this study, we provide genetic evidence of a critical and nonredundant role of MAPK phosphatase (MKP)-1 in the negative control of MAPK-regulated inflammatory reactions in vivo. MKP-1−/− mice are hyperresponsive to low-dose LPS-induced toxicity and exhibit significantly increased serum TNF-α, IL-6, IL-12, MCP-1, IFN-γ, and IL-10 levels after systemic administration of LPS. Furthermore, absence of MKP-1 increases systemic levels of proinflammatory cytokines and exacerbates disease development in a mouse model of rheumatoid arthritis. When activated through TLR2, TLR3, TLR4, TLR5, and TLR9, bone marrow-derived MKP-1−/− macrophages exhibit increased cytokine production and elevated expression of the differentiation markers B7.2 (CD86) and CD40. MKP-1-deficient macrophages also show enhanced constitutive and TLR-induced activation of p38 MAPK. Based on these findings, we propose that MKP-1 is an essential component of the intracellular homeostasis that controls the threshold and magnitude of p38 MAPK activation in macrophages, and inflammatory conditions accentuate the significance of this regulatory function.

show abstract

Section: Discussionmentioning

confidence: 99%

Essential Role of MAPK Phosphatase-1 in the Negative Control of Innate Immune Responses

Salojin

Owusu

Millerchip

et al. 2006

The Journal of Immunology

311

286

View full text Add to dashboard Cite

show abstract

“…Yet pathogen derived molecules are capable of inducing experimental arthritis. For example, stimulation of TLR2, 3, 4, 9 can initiate and/or and aggravate numerous models of arthritis, for example those driven by streptococcal cell wall [32], dsRNA, LPS [33,34] and CpG DNA [35]. These studies clearly define roles for specific TLRs.…”

Section: Activation Of Dcs As Autoimmune Mediatorsmentioning

confidence: 97%

Dendritic Cell Biology in Animal Models of Arthritis

Benson¹,

Brewer²,

Garside³

et al. 2010

Open Arth J

View full text Add to dashboard Cite

Abstract:In recent years the treatment of rheumatoid arthritis (RA) has changed considerably with the advent of novel biologic agents that target cytokines such as TNF. The impact on clinical practice has been considerable with achievement of high hurdle endpoints and reduced articular damage. Unfortunately, remission that is long lasting is rarely achieved and almost never reached in the absence of chronic drug therapy. Thus, interest in what should be the critical objective of autoimmune therapeutics -the re-establishment of self-tolerance -has become increasingly prominent.Models of experimental arthritis have only just begun to reveal the intricacies of dendritic cell (DC) biology in RA. And while manipulation of antigen presenting cells such as DCs can be used in the suppression of experimental arthritis, the basic functions and mechanisms regarding their impact is mostly obtained indirectly by inference from other autoimmune and infectious studies. Indeed, our understanding of the contribution of DC biology to induction and perpetuation of RA is relatively ill defined. Here we discuss recent advances in understanding basic DC biology, their roles in, and impact on, experimental arthropathy and resulting therapeutic implications. It is essential that more research into the direct contribution of DC activity in RA is forthcoming, particularly as they could hold the key to development of antigen specific therapeutics. The major contributing factor to this knowledge deficit is the difficulty inherent in investigating what are most likely pre-clinical immunological events, an area more suited to study in animal models.

show abstract

“…Under some conditions, these effects can result in inflammatory responses. Aggravating joint inflammation, which is characterized by cell activation, draining lymph nodes, and increased levels of the acute-phase reactant α1-acid glycoprotein in sera, has been discovered in CpG ODN-injected rats [58]. Svelander et al [58] demonstrated that injection with either a phosphorothioated or a native form of CpG ODN can elevate a T cell-dependent, joint-specific inflammation.…”

Section: Possible Side-effects Of Cpg Odnsmentioning

confidence: 97%

“…Aggravating joint inflammation, which is characterized by cell activation, draining lymph nodes, and increased levels of the acute-phase reactant α1-acid glycoprotein in sera, has been discovered in CpG ODN-injected rats [58]. Svelander et al [58] demonstrated that injection with either a phosphorothioated or a native form of CpG ODN can elevate a T cell-dependent, joint-specific inflammation. Their results indicated that exposure to bacterial DNA during infection might contribute to arthritis induction, due to TCCATGACGTTCCTGATGCT Edwardsiella tarda ↑ Survival rate [46] a The normal letter means CpG ODNs with phosphorothioate-linked backbone whereas the capitalized letter means CpG ONDs with phosphodiester-linked backbone.…”

Section: Possible Side-effects Of Cpg Odnsmentioning

confidence: 97%

CpG oligodeoxynucleotides as DNA adjuvants in vertebrates and their applications in immunotherapy

Chaung

2006

International Immunopharmacology

View full text Add to dashboard Cite

Oligodeoxynucleotides containing CpG motifs can induce T cell–dependent arthritis in rats

Cited by 20 publications

References 31 publications

Essential Role of MAPK Phosphatase-1 in the Negative Control of Innate Immune Responses

Essential Role of MAPK Phosphatase-1 in the Negative Control of Innate Immune Responses

Dendritic Cell Biology in Animal Models of Arthritis

CpG oligodeoxynucleotides as DNA adjuvants in vertebrates and their applications in immunotherapy

Contact Info

Product

Resources

About