On the Origin of the Eukaryotic Chromosome: The Role of Noncanonical DNA Structures in Telomere Evolution

Garavís, Miguel; González, Carlos; Villasanté, Alfredo

doi:10.1093/gbe/evt079

Cited by 57 publications

(49 citation statements)

References 95 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…1 A). The key points of CFTH described above have good support in the literature [Villasante et al, 2007a;Garavís et al, 2013]. However, the requirement for any scientific hypothesis is that it is testable.…”

Section: How Did the Centromere Evolve?mentioning

confidence: 86%

“…The first assumption of CFTH is that eukaryogenesis was prompted by the adaptation of the bacterial symbiont and the archaeal host to their new conditions. As part of the adaptation process, the symbiont's class II introns, a class of retrotransposons, invaded the host's circular genome and caused its fragmentation into linear DNA molecules [Garavís et al, 2013]. The genome fragmentation resulted in free DNA ends which became opportunistic targets for mobile genetic elements from the host's genome, such as non-LTR retrotransposons, eventually leading to stabilization of free DNA ends and formation of proto-telomeres resulting in the formation of the first proto-eukaryotic linear chromosomes [Garavís et al, 2013].…”

Section: Telomere Length Regulation In the Light Of Cfthmentioning

confidence: 99%

See 1 more Smart Citation

Mechanisms of the Evolutionary Chromosome Plasticity: Integrating the ‘Centromere-from-Telomere' Hypothesis with Telomere Length Regulation

Slijepčević¹

2016

Cytogenet Genome Res

View full text Add to dashboard Cite

The ‘centromere-from-telomere' hypothesis proposed by Villasante et al. [2007a] aims to explain the evolutionary origin of the eukaryotic chromosome. The hypothesis is based on the notion that the process of eukaryogenesis was initiated by adaptive responses of the symbiont eubacterium and its archaeal host to their new conditions. The adaptive responses included fragmentation of the circular genome of the host into multiple linear fragments with free DNA ends. The action of mobile genetic elements stabilized the free DNA ends resulting in the formation of proto-telomeres. Sequences next to the proto-telomeres, the subtelomeric sequences, were immediately targeted as the new cargo by the tubulin-based cytoskeleton, thus becoming proto-centromeres. A period of genomic instability followed. Eventually, functioning centromeres and telomeres emerged heralding the arrival of the eukaryotic chromosome in the evolution. This paper expands the ‘centromere-from-telomere' hypothesis by integrating it with 2 sets of data: chromosome-specific telomere length distribution and chromomere size gradient. The integration adds a new dimension to the hypothesis but also provides an insight into the mechanisms of chromosome plasticity underlying karyotype evolution.

show abstract

Section: How Did the Centromere Evolve?mentioning

confidence: 86%

Section: Telomere Length Regulation In the Light Of Cfthmentioning

confidence: 99%

Mechanisms of the Evolutionary Chromosome Plasticity: Integrating the ‘Centromere-from-Telomere' Hypothesis with Telomere Length Regulation

Slijepčević¹

2016

Cytogenet Genome Res

View full text Add to dashboard Cite

show abstract

“…However, at that time this motif was detected only on chromosomes of certain aculeate Hymenoptera, i.e., the honeybee, Apis mellifera Linnaeus, 1758, from the family Apidae as well as about 20 ant species (Formicidae), using either FISH or SBH (Lorite, Carrillo, & Palomeque, 2002;Meyne & Imai, 1995; see also Korandová et al, 2014;Okazaki et al, 1993;Pereira, dos Reis, Cardoso, & Cristiano, 2018;Wurm et al, 2011). Interestingly, the telomeres of A. mellifera appeared to be a mosaic of short TTAGG repeats interspersed with TCAGGCTGGG, TCAGGCTGGGTTGGG, and TCAGGCTGGGTGAGGATGGG higher order repeat arrays (Garavís et al, 2013). Furthermore, the first fully sequenced parasitoid genome of Nasonia vitripennis (Walker, 1836) (Chalcidoidea, Pteromalidae), together with genomes of two other members of the same genus, was found to lack the TTAGG telomeric repeat, although the seemingly intact telomerase gene was detected in has been demonstrated by Gokhman and Kuznetsova (2018).…”

Section: Coleoptera (Beetles)mentioning

confidence: 99%

“…The latter mechanism therefore usually activates when normal functioning of the telomerase becomes problematic (Osanai, Kojima, Futahashi, Yaguchi, & Fujiwara, ). Nevertheless, both telomeric repeats and telomerase (as well as the telomerase‐coding gene) lack in all studied members of the order Diptera (Garavís, González, & Villasante, ; Rosén, Kamnert, & Edström, ) suggesting that this mechanism is fully replaced by ALT.…”

Section: Introductionmentioning

confidence: 99%

Telomere structure in insects: A review

Kuznetsova

Grozeva

Gokhman

2019

J Zool Syst Evol Res

View full text Add to dashboard Cite

Telomeres are terminal regions of chromosomes, which protect them from fusion with other chromosomes and stabilize their structure. Telomeres usually contain specific DNA repeats (motifs), which are maintained by telomerase, a kind of reverse transcriptase. In this review, we survey the current state of knowledge of telomere motifs in insects. Among Hexapoda, data on telomere composition are available for more than 350 species from 108 families and 25 orders. The telomere motif (TTAGG) n is considered ancestral for the class Insecta. However, certain insects have different and often unknown telomeric sequences. This apparently happens because telomerase-dependent mechanisms usually coexist with various means of alternative lengthening of telomeres as backup mechanisms of telomere maintenance. This coexistence can explain losses and reappearances of the TTAGG repeat and telomerase-dependent telomere replication in insect evolution. For example, a few higher taxa, such as Heteroptera (Hemiptera) and Hymenoptera, show presence of the (TTAGG) n motif in their basal clades as well as a subsequent loss and, at least in the Hymenoptera, independent reappearance of this repeat in some advanced groups. Analogously, most members of Coleoptera also retain the TTAGG repeat, although it is changed to TCAGG in certain families. Furthermore, the (TTAGG) n motif seems to have been irreversibly lost in the order Diptera. In this group, telomeric sequences are represented either by long terminal repeats or by retrotransposons. Retrotransposons are also interspersed with other telomeric sequences in many groups of insects. The accumulating data demonstrate that the class Insecta is substantially diverse in terms of its telomere structure. K E Y W O R D Schromosomes, FISH, insects, TTAGG, retrotransposons 128 |

show abstract

“…However, this alternative can be ruled out in our target taxa, since no ITS co-localized with the NORs in any of species examined here. Finally, telomeres appear to be the evolutionary precursors of eukaryote centromeres [Villasante et al, 2007;Mendez-Lago et al, 2009; 300 Garavis et al, 2013], and telomeric DNA may give rise to neocentromeres [Villa sante et al, 2007;Ishii et al, 2008] as reported in plants, invertebrates, and mammals [Fukagawa and Earnshaw, 2014;Steiner and Henikoff, 2015]. But whether some of the observed turtle ITS represent evolutionary neocentromeres remains to be tested.…”

Section: Turtle Telomere Evolutionmentioning

confidence: 99%

Cytogenetic Insights into the Evolution of Chromosomes and Sex Determination Reveal Striking Homology of Turtle Sex Chromosomes to Amphibian Autosomes

Montiel

Badenhorst²,

Lee³

et al. 2016

Cytogenet Genome Res

136

View full text Add to dashboard Cite

Turtle karyotypes are highly conserved compared to other vertebrates; yet, variation in diploid number (2n = 26-68) reflects profound genomic reorganization, which correlates with evolutionary turnovers in sex determination. We evaluate the published literature and newly collected comparative cytogenetic data (G- and C-banding, 18S-NOR, and telomere-FISH mapping) from 13 species spanning 2n = 28-68 to revisit turtle genome evolution and sex determination. Interstitial telomeric sites were detected in multiple lineages that underwent diploid number and sex determination turnovers, suggesting chromosomal rearrangements. C-banding revealed potential interspecific variation in centromere composition and interstitial heterochromatin at secondary constrictions. 18S-NORs were detected in secondary constrictions in a single chromosomal pair per species, refuting previous reports of multiple NORs in turtles. 18S-NORs are linked to ZW chromosomes in Apalone and Pelodiscus and to X (not Y) in Staurotypus. Notably, comparative genomics across amniotes revealed that the sex chromosomes of several turtles, as well as mammals and some lizards, are homologous to components of Xenopus tropicalis XTR1 (carrying Dmrt1). Other turtle sex chromosomes are homologous to XTR4 (carrying Wt1). Interestingly, all known turtle sex chromosomes, except in Trionychidae, evolved via inversions around Dmrt1 or Wt1. Thus, XTR1 appears to represent an amniote proto-sex chromosome (perhaps linked ancestrally to XTR4) that gave rise to turtle and other amniote sex chromosomes.

show abstract

On the Origin of the Eukaryotic Chromosome: The Role of Noncanonical DNA Structures in Telomere Evolution

Cited by 57 publications

References 95 publications

Mechanisms of the Evolutionary Chromosome Plasticity: Integrating the ‘Centromere-from-Telomere' Hypothesis with Telomere Length Regulation

Mechanisms of the Evolutionary Chromosome Plasticity: Integrating the ‘Centromere-from-Telomere' Hypothesis with Telomere Length Regulation

Telomere structure in insects: A review

Cytogenetic Insights into the Evolution of Chromosomes and Sex Determination Reveal Striking Homology of Turtle Sex Chromosomes to Amphibian Autosomes

Contact Info

Product

Resources

About