On the site by which α‐dendrotoxin binds to voltage‐dependent potassium channels: Site‐directed mutagenesis reveals that the lysine triplet 28–30 is not essential for binding

Abstract

We constructed a synthetic gene encoding the published amino acid sequence of DTx from Dendroaspis angusticeps, a ligand of voltagedependent postassium channels that facilitates neurotransmitter release. We expressed it in Escherichia coli as a fusion protein secreted in the culture medium. The recombinant DTx was generated in vitro by chemical treatment and recovered as two isoforms. One of them (rDTx), like the venom toxin, has an N-terminal pyroglutamate whereas the other (rQDTx) has a free N-terminal glutamine. Chromatographic differences between rDTx and natural DTx led us to re-examine the amino acid sequence of natural DTx. In contrast to what was previously published, position 12 was an Asp and not Asn. Despite this difference, rDTx and DTx had similar toxicity in mice and binding affinity to synaptosomes, suggesting that residue 12 is not important for DTx function. Nor is the N-terminal residue implicated in DTx function since rDTx and QDTx also had similar biological activities. We also synthesized and expressed a mutant of the DTx gene in which the lysine triplet 28-30 was changed into Ala-Ala-Gly. The two resulting recombinant isoforms exhibited only small decreases in biological activity, excluding the possibility that the positively charged lysine triplet 28-30 of DTx is directly involved in the toxin functional site.

A Recombinant Insect‐Specific α‐Toxin of Buthus occitanus tunetanus Scorpion Confers Protection Against Homologous Mammal Toxins

“…The sense oligonucleotide (5' GGGAGCG-GAGGGTACCCATGGTACGTGACGGTTATATT 3') introduced a KpnI restriction site (underlined), and a methionine residue (bold) at position -1. Since the mature sequence of BotXIV has no methionine residue, it constitutes a unique and useful CNBr-cleavage site, as previously described for other hybrid snake toxins (Ducancel et al, 1989;Boyot et al, 1990;Hodgson et al, 1993;Danse et al, 1994). The antisense oligonucleotide (S'GGGAGCGGCAGGATCCTTATCAGCGATGGCATTTT 3') was designed to introduce a BamHI restriction site and the stop codon TAA (bold), which is efficiently recognized in E. coli.…”

“…BomIII (Vargas et al, 1987) presents the highest similarity (70%) with BotXIV. The system chosen to express BotXlV in E. coli was previously demonstrated to be suited to the production of soluble, correctly folded snake venom toxins (Ducancel et al, 1989;Hodgson et al, 1993;Pillet et al, 1993;Danse et al, 1994;TrCmeau et al, 1995). This system, however, had not been used to produce recombinant scorpion toxins.…”

Novel effects of dendrotoxin homologues on subtypes of mammalian Kv1 potassium channels expressed in Xenopus oocytes

“…Our results may Jso help to identify which amino acids on the toxin and on the channel are necessary to confer high affinity block and -electivity. Previous approaches using both mutated channels I I0] and toxins [11] have revealed that several regions on both the toxin and channel a-subunit are required for full activity.…”

A bifunctional sea anemone peptide with Kunitz type protease and potassium channel inhibiting properties

“…Substituting Arg1 by alanine resulted in a less than 10-fold decreased affinity, whereas Arg2, Leu4 and Ile6 substitution lowered the affinity 10 to 30 times. The Lys3 and Leu6 seem to be the most critical residues since mutating these amino acids resulted in a thousand times less potent toxins [30,31,35,36]. Of these residues critical for α-DTX binding, the leu4 and Ile6 are replaced by a homologous residue in APEKTx1.…”