Oncogenic association of the Cbp/PAG adaptor protein with the Lyn tyrosine kinase in human B-NHL rafts

Abstract

B-non-Hodgkin lymphomas (B-NHLs IntroductionHuman lymphomas develop mainly from B lymphocytes after chromosomal translocations involving the IgH promoter and an oncogene, 1,2 but the type-specific molecular basis for lymphoma cell proliferation remains largely unknown. 1 It was recently suggested that, in B-cell lymphomas, CD40 and its ligand CD154 were coexpressed and associated in a raft-based signalosome leading to constitutive expression of Considering that the Lyn Src-family kinase and the Cbp/PAG adaptor are the major phosphotyrosylated proteins of lymphoma rafts, 4,5 and therefore components of a proximal signaling platform, 6 we set out to investigate their membrane organization and oncogenic potential in a panel of human B/T non-Hodgkin and Hodgkin lymphoma cell lines and tissues.In normal lymphocytes, the Csk-binding protein (Cbp)/ phosphoprotein associated with glycosphingolipid-enriched microdomains (PAG) adaptor 7-9 is a major phosphotyrosylated protein involved in the negative regulation of signaling in murine T lymphocytes [10][11][12][13] and mast cells. 14 Cbp/PAG (hereafter PAG), phosphorylated at tyrosine 317, was shown to bind Csk 15 and allow phosphorylation of the Src-kinase C-terminal regulatory tyrosine and inactivation of the Src kinase. 16,17 PAG is tyrosine phosphorylated in resting T lymphocytes and rapidly dephosphorylated upon activation. 10,11,16,17 Likewise, tyrosine phosphorylated PAG associated with Csk was shown to inhibit bovine B lymphocyte proliferation. 18 In contrast, several human B-non-Hodgkin lymphoma (B-NHL) cell lines proliferate with a tyrosine phosphorylated PAG adaptor, 4 suggesting that, in lymphoma cells, this form of PAG rather promotes proliferation.PAG is a 432-amino acid protein localized in sphingolipidenriched membrane microdomains. 19 The cytoplasmic portion of the PAG single transmembrane protein contains 10 phosphorylatable tyrosines and 2 proline-rich domains (residues 131-138 and 257-263), to potentially interact with SH2 and SH3 domains, respectively. Palmitoylation facilitates PAG association with rafts 8 and contributes to the formation of a "lipid shell" around PAG in sphingolipid and cholesterol-rich domains. 20 We investigated how PAG, Lyn, and Csk interact within membrane microdomains in B-NHLs (Burkitt, follicular, mantle cell, and diffuse large B-cell lymphomas of both germinal centerand activated B cell-type), anaplastic large cell T lymphomas (ALCLs) expressing the nucleophosmin-anaplastic lymphoma kinase (NPM-ALK) fusion protein (ALK ϩ lymphomas) and Hodgkin lymphoma-derived cell lines and tissues. The PAG protein was expressed in all those cells, but only in B-NHL lines did the phosphorylated PAG protein associate with sphingolipid-enriched membrane domains (or rafts) and strongly interact with Lyn. The phosphorylated signal transducer and activator of transcription 3 (STAT3) was also part of the Lyn/PAG raft complex in B-NHL lines and tissues and may modulate gene expression under the control of the Lyn/PAG signalosome. The online versio...

Src family tyrosine kinases-driven colon cancer cell invasion is induced by Csk membrane delocalization

“…PAG was originally identified as a Csk-binder, implicating phosphorylation of Tyr317 on PAG, but it contains eight additional SFK phosphorylation sites, allowing interaction with SH2-containing proteins, two poly-Pro motifs for interaction with SH3-containing proteins and two palmitoylation sites implicated in lipid rafts localization (Horejsi et al, 2004). Known interactors include the E3-ligase SOCS1 (Ingley et al, 2006), the negative Ras regulator RasGAP (Smida et al, 2007) and SFK themselves Solheim et al, 2008;Tauzin et al, 2008). Besides, we recently reported an unanticipated interaction between PAG N-terminus and the Neu-3 sialidase (Veracini et al, 2008), controlling lipid raft properties (Miyagi et al, 2008).…”

“…Accordingly, a negative function has been recently reported in CRC tumour growth after xenotransplantation into immunodeficient mouse , but the underlying mechanism has not been addressed. Moreover, by sequestering SFK in lipid rafts, PAG inhibits Src-transforming activity in mouse fibroblasts , but promotes Lyn oncogenic activity in B lymphoma (Tauzin et al, 2008). In both cases, PAG effects were independent of Csk.…”

Overexpression of Csk-binding protein contributes to renal cell carcinogenesis

“…Silencing of Cbp by small interfering RNA Two siRNAs targeting position 269-289 (GGGACAUUCUUU CAGAGGACA; named Cbp-Ri-3) and position 1174-1194 (AAGCGAUACAGACUCUCAACA; named Cbp-Ri-5; Shima et al, 2003;Tauzin et al, 2008) of human Cbp mRNA were selected. The scrambled siRNA of Cbp-Ri-3 (3-neg) (CUAUAG GAUGAUCUGGCGAAC) was used as a negative control.…”

“…High expression of Cbp has been seen in follicle-center-derived lymphoma and some diffuse large B-cell lymphomas, where it appears to promote the oncogenic role of Lyn (Tauzin et al, 2008). A human protein atlas for normal and cancer tissues based on antibody proteomics was newly developed (Uhlen et al, 2005;Mathivanan et al, 2008; http://www.proteinatlas.…”

“…It is reported to form a protein complex with Lyn and active Stat3 in B-non-Hodgkin lymphomas. In this example, it appears to promote the oncogenic role of Lyn, because knocking down Cbp in these tumor cells leads to cell apoptosis (Tauzin et al, 2008). Moreover, strong expression of Cbp has also been found in a subset of lymphomas, including B-non-Hodgkin lymphomas (Svec et al, 2005;Tedoldi et al, 2006;Svec, 2007).…”