Oncolytic measles virus encoding interleukin-12 mediates potent antitumor effects through T cell activation

Veinalde, Rūta; Grossardt, Christian; Hartmann, Linda; Bourgeois-Daigneault, Marie Claude; Bell, John C.; Jäger, Dirk; Kalle, Christof von; Ungerechts, Guy; Engeland, Christine E.

doi:10.1080/2162402x.2017.1285992

Cited by 66 publications

(73 citation statements)

References 43 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Recombinant measles viruses (MeV) of the Schwarz vaccine strain (MeVac) were generated using the reverse genetics system originally described by Radecke et al [36] with the modifications described previously [22,37]. MeVac encoding enhanced green fluorescent protein (eGFP) has been described previously [20]. To obtain cDNA of the ovalbumin and mTRP-2 open reading frames (ORFs), total RNA was extracted from B16-OVA cells using the RNeasy Mini Kit (Qiagen, Hilden, Germany) and cDNA synthesis was performed using the Maxima H Minus First Strand cDNA Synthesis Kit (ThermoFisher, Dreieich, Germany).…”

Section: Cloning Rescue and Propagation Of Recombinant Measles Vaccimentioning

confidence: 99%

“…ggOVA MluI for (5 →3 ) tttacgcgtgccaccatgggctccatcggcg ggOVA AscI rev (5 →3 ) tttggcgcgcctattaaggggaaacacatctgcca mTRP-2 MluI for (5 →3 ) tttacgcgtgccaccatgggccttgtggga mTRP-2 AscI rev (5 →3 ) tttggcgcgcctaggcttcctccgtgt Ovalbumin and TRP-2 ORFs were inserted into a recombinant MeV harboring an additional transcription unit downstream of the MeV H gene [20], yielding pcMeVac OVA and pcMeVac TRP-2. To generate MeV encoding epitope cassette variants (MeVac OVA, MeVac TRP-2), synthetic oligonucleotides were designed and obtained from Eurofins (Ebersberg, Germany).…”

Section: Cloning Rescue and Propagation Of Recombinant Measles Vaccimentioning

confidence: 99%

“…The advantages of oncolytic measles vaccines include the well documented safety record, genomic stability, and the versatility of the reverse genetics system [2,14,15]. Insertion of immunomodulatory genes encoding cytokines, chemokines or immune checkpoint antibodies into the oncolytic vector can enhance anti-tumor immunity [16][17][18][19][20][21][22][23].…”

Section: Introductionmentioning

confidence: 99%

See 2 more Smart Citations

Measles Vaccines Designed for Enhanced CD8+ T Cell Activation

Busch

Kubon

Mayer

et al. 2020

Viruses

Self Cite

View full text Add to dashboard Cite

Priming and activation of CD8 + T cell responses is crucial to achieve anti-viral and anti-tumor immunity. Live attenuated measles vaccine strains have been used successfully for immunization for decades and are currently investigated in trials of oncolytic virotherapy. The available reverse genetics systems allow for insertion of additional genes, including heterologous antigens. Here, we designed recombinant measles vaccine vectors for priming and activation of antigen-specific CD8 + T cells. For proof-of-concept, we used cytotoxic T lymphocyte (CTL) lines specific for the melanoma-associated differentiation antigen tyrosinase-related protein-2 (TRP-2), or the model antigen chicken ovalbumin (OVA), respectively. We generated recombinant measles vaccine vectors with TRP-2 and OVA epitope cassette variants for expression of the full-length antigen or the respective immunodominant CD8 + epitope, with additional variants mediating secretion or proteasomal degradation of the epitope. We show that these recombinant measles virus vectors mediate varying levels of MHC class I (MHC-I)-restricted epitope presentation, leading to activation of cognate CTLs, as indicated by secretion of interferon-gamma (IFNγ) in vitro. Importantly, the recombinant OVA vaccines also mediate priming of naïve OT-I CD8 + T cells by dendritic cells. While all vaccine variants can prime and activate cognate T cells, IFNγ release was enhanced using a secreted epitope variant and a variant with epitope strings targeted to the proteasome. The principles presented in this study will facilitate the design of recombinant vaccines to elicit CD8 + responses against pathogens and tumor antigens.

show abstract

Section: Cloning Rescue and Propagation Of Recombinant Measles Vaccimentioning

confidence: 99%

Section: Cloning Rescue and Propagation Of Recombinant Measles Vaccimentioning

confidence: 99%

Section: Introductionmentioning

confidence: 99%

See 1 more Smart Citation

Measles Vaccines Designed for Enhanced CD8+ T Cell Activation

Busch

Kubon

Mayer

et al. 2020

Viruses

Self Cite

View full text Add to dashboard Cite

show abstract

“…41,199 Along the lines of our Trial Watch series, here we discuss recent preclinical and clinical advances in the development of ICD-inducing chemotherapeutic regimens. 200 Several other interventions that trigger bona fide ICD, such as radiation therapy administered according to specific regimens, 94,[201][202][203] high hydrostatic pressure, 3,4 oncolytic virotherapy [204][205][206][207][208] and photodynamic therapy, 44,86,98,99 are not discussed here in further detail.…”

Section: Introductionmentioning

confidence: 99%

Trial watch: Immunogenic cell death induction by anticancer chemotherapeutics

et al. 2017

View full text Add to dashboard Cite

The expression "immunogenic cell death" (ICD) refers to a functionally unique form of cell death that facilitates (instead of suppressing) a T cell-dependent immune response specific for dead cell-derived antigens. ICD critically relies on the activation of adaptive responses in dying cells, culminating with the exposure or secretion of immunostimulatory molecules commonly referred to as "damage-associated molecular patterns". Only a few agents can elicit bona fide ICD, including some clinically established chemotherapeutics such as doxorubicin, epirubicin, idarubicin, mitoxantrone, bleomycin, bortezomib, cyclophosphamide and oxaliplatin. In this Trial Watch, we discuss recent progress on the development of ICD-inducing chemotherapeutic regimens, focusing on studies that evaluate clinical efficacy in conjunction with immunological biomarkers.

show abstract

“…by regulatory T cells (Tregs) [95]. Based on this understanding, current development of novel oncolytic vectors focuses not only on enhancing lytic replication, but also on harnessing the immune response, for example by the introduction of transgenes encoding cytokines [96,97], checkpoint inhibitors [98], ligands of T cell co-stimulatory receptors [99], bispecific T cell engagers [100][101][102] or tumor antigens [103][104][105], respectively, into the viral backbone. Combination therapies represent another approach to support immune responses to OV treatment, including additional application of cytokines [106], immune checkpoint inhibitors [107,108] or chemotherapeutics [109].…”

Section: Modes Of Action In Oncolytic Virotherapymentioning

confidence: 99%

Fighting Cancer with Mathematics and Viruses

Santiago¹,

Heidbuechel²,

Kandell³

et al. 2017

Preprint

Self Cite

View full text Add to dashboard Cite

After decades of research, oncolytic virotherapy has recently advanced to clinical application, and currently a multitude of novel agents and combination treatments are being evaluated for cancer therapy. Oncolytic agents preferentially replicate in tumor cells, inducing tumor cell lysis and complex anti-tumor effects, such as innate and adaptive immune responses and the destruction of tumor vasculature. With the availability of different vector platforms and the potential of both genetic engineering and combination regimens to enhance particular aspects of safety and efficacy, the identification of optimal treatments for patient subpopulations or even individual patients becomes a top priority. Mathematical modeling can provide support in this arena by making use of experimental and clinical data to generate hypotheses about the mechanisms underlying complex biology and, ultimately, predict optimal treatment protocols. Increasingly complex models can be applied to account for therapeutically relevant parameters such as components of the immune system. In this review, we describe current developments in oncolytic virotherapy and mathematical modeling to discuss the benefit of integrating different modeling approaches into biological and clinical experimentation. Conclusively, we propose a mutual combination of these fields of research for more efficient development and effective treatments.

show abstract

Oncolytic measles virus encoding interleukin-12 mediates potent antitumor effects through T cell activation

Cited by 66 publications

References 43 publications

Measles Vaccines Designed for Enhanced CD8+ T Cell Activation

Measles Vaccines Designed for Enhanced CD8+ T Cell Activation

Trial watch: Immunogenic cell death induction by anticancer chemotherapeutics

Fighting Cancer with Mathematics and Viruses

Contact Info

Product

Resources

About