One-Step Generation of Mice Carrying Mutations in Multiple Genes by CRISPR/Cas-Mediated Genome Engineering

Abstract

Summary Mice carrying mutations in multiple genes are traditionally generated by sequential recombination in embryonic stem cells and/or time-consuming intercrossing of mice with a single mutation. The CRISPR/Cas system has been adapted as an efficient gene-targeting technology with the potential for multiplexed genome editing. We demonstrate that CRISPR/Cas-mediated gene editing allows the simultaneous disruption of five genes (Tet1, 2, 3, Sry, Uty - 8 alleles) in mouse embryonic stem (ES) cells with high efficiency. Coinjection of Cas9 mRNA and single-guide RNAs (sgRNAs) targeting Tet1 and Tet2 into zygotes generated mice with biallelic mutations in both genes with an efficiency of 80%. Finally, we show that coinjection of Cas9 mRNA/sgRNAs with mutant oligos generated precise point mutations simultaneously in two target genes. Thus, the CRISPR/Cas system allows the one-step generation of animals carrying mutations in multiple genes, an approach that will greatly accelerate the in vivo study of functionally redundant genes and of epistatic gene interactions.

A point mutation in the Ncr1 signal peptide impairs the development of innate lymphoid cell subsets

“…Thus, we could not be completely certain that the effects identified in NKp46 expression in these mice are due solely to the C14R mutation detected in the Ncr1 gene. To determine whether this was indeed the case, we generated mice using the CRISPR/Cas9 technology 33 that would carry only the C14R mutation on a C57BL/6 background. These mice are designated as the NCR B6C14R strain and were healthy, viable and bred normally to produce homozygous animals.…”

“…33 Briefly, one sgRNA of the sequence TAGGGCTATGTCTGAGCCAG (10ng/μl), an oligo donor of the sequence (gttgaatcaagagcagattggggggagacagcatgccattaaccctgttttctagGGCTACGACTGAGCCAGCGTATCAACACTGAAAAGGgtaagtccttccctcgaagtctcagggttgttcttatgggttca; 10ng/ul) and Cas9 mRNA (5ng/μl) were injected into the cytosol of C57BL/6J zygotes to generate NCR B6C14R point mutant mice.…”

Chromosome engineering in zygotes with CRISPR/Cas9

“…The CRISPR/Cas9 system is a very efficient and comparatively fast method to generate genome edited mice with small modifications such as insertion–deletions of a few nucleotides and the introduction of short tags via direct injection in zygotes (Wang et al ., 2013; Yang et al ., 2013, 2014). Here we extend this technology to very large chromosomal rearrangements, facilitating the facile generation of mouse models with this important class of structural variants.…”

Human Germline Genome Editing

“…First, they can be easily customized to target specific sequences via alteration of only a small number of nucleotides in the guide RNA (20 nucleotides in the case of Streptococcus pyogenes CRISPR/Cas9)-a simple, fast, and inexpensive process that is much simpler than previous gene-editing methods. Second, RNA-guided nucleases are dramatically efficient at cleaving target genomic sequences in some cell types and organs [10][11][12] -so much so that for many applications, the delivery of the protein and RNA components into target cells, rather than the targeting itself, is now the main rate-limiting step in genome editing.…”