Opposing roles for distinct LINC complexes in regulation of the small GTPase RhoA

Thakar, Ketan; May, Christopher; Rogers, Anna J.; Carroll, Christopher W.

doi:10.1091/mbc.e16-06-0467

Cited by 60 publications

(91 citation statements)

References 70 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Equally important is to discover how the Emerin-independent functions of Lamins A/C promote Mkl1 nuclear localization in cells grown on stiff substrates. We have demonstrated recently that nuclear envelopespanning linker of nucleoskeleton and cytoskeleton (LINC) complexes, which couple F-actin, microtubules and intermediate filaments to the nuclear lamina, promote focal adhesion assembly through a transcription-independent mechanism (Thakar et al, 2017). Thus, Lamins A/C could enhance Mkl1 nuclear accumulation through LINC complexes in Emd KO cells.…”

Section: Stably Expressed Constitutively Active Mkl1 Bypasses the Reqmentioning

confidence: 99%

“…Emerin localization to the INM or ONM was quantified by measuring the intensity levels of Emerin fluorescence at the nuclear envelope in Triton X-100 or digitoninpermeabilized cells, respectively (Le et al, 2016). Focal adhesions were quantified as described (Thakar et al, 2017). The area of all FAs from each cell was summed and then divided by the cell area to determine total FA area per cell and the percent of vinculin-positive area per cell, respectively.…”

Section: Indirect Immunofluorescence and Confocal Microscopymentioning

confidence: 99%

See 1 more Smart Citation

Substrate stiffness-dependent regulation of the SRF−Mkl1 co-activator complex requires the inner nuclear membrane protein Emerin

Willer

Carroll

2017

Journal of Cell Science

Self Cite

View full text Add to dashboard Cite

The complex comprising serum response factor (SRF) and megakaryoblastic leukemia 1 protein (Mkl1) promotes myofibroblast differentiation during wound healing. SRF−Mkl1 is sensitive to the mechanical properties of the extracellular environment; but how cells sense and transduce mechanical cues to modulate SRF−Mkl1-dependent gene expression is not well understood. Here, we demonstrate that the nuclear lamina-associated inner nuclear membrane protein Emerin stimulates SRF−Mkl1-dependent gene activity in a substrate stiffness-dependent manner. Specifically, Emerin was required for Mkl1 nuclear accumulation and maximal SRF−Mkl1-dependent gene expression in response to serum stimulation of cells grown on stiff substrates but was dispensable on more compliant substrates. Focal adhesion area was also reduced in cells lacking Emerin, consistent with a role for Emerin in sensing substrate stiffness. Expression of a constitutively active form of Mkl1 bypassed the requirement for Emerin in SRF−Mkl1-dependent gene expression and reversed the focal adhesion defects evident in Emd KO fibroblasts. Together, these data indicate that Emerin, a conserved nuclear lamina protein, couples extracellular matrix mechanics and SRF−Mkl1-dependent transcription.

show abstract

Section: Stably Expressed Constitutively Active Mkl1 Bypasses the Reqmentioning

confidence: 99%

Section: Indirect Immunofluorescence and Confocal Microscopymentioning

confidence: 99%

Substrate stiffness-dependent regulation of the SRF−Mkl1 co-activator complex requires the inner nuclear membrane protein Emerin

Willer

Carroll

2017

Journal of Cell Science

Self Cite

View full text Add to dashboard Cite

show abstract

“…Feedback also exists between the NE and matrix adhesions and disruption of lamins A/C function or overexpression of the dominant negative nesprin KASH-domain triggers focal adhesion reorganisation and changes in cell motility [18][19][20]. The nature of this feedback remains unknown, however, lamin A/C and SUN2 have recently been demonstrated to regulate Rac1 and RhoA activity, respectively [20,21]. Although in some contexts LINC complex components are partially redundant, several lines of data suggest that the LINC complex is tailored for cell-type-specific functions.…”

Section: Introductionmentioning

confidence: 99%

SUN1/2 Are Essential for RhoA/ROCK-Regulated Actomyosin Activity in Isolated Vascular Smooth Muscle Cells

Porter

Minaisah

Ahmed

et al. 2020

Cells

View full text Add to dashboard Cite

Vascular smooth muscle cells (VSMCs) are the predominant cell type in the blood vessel wall. Changes in VSMC actomyosin activity and morphology are prevalent in cardiovascular disease. The actin cytoskeleton actively defines cellular shape and the LInker of Nucleoskeleton and Cytoskeleton (LINC) complex, comprised of nesprin and the Sad1p, UNC-84 (SUN)-domain family members SUN1/2, has emerged as a key regulator of actin cytoskeletal organisation. Although SUN1 and SUN2 function is partially redundant, they possess specific functions and LINC complex composition is tailored for cell-type-specific functions. We investigated the importance of SUN1 and SUN2 in regulating actomyosin activity and cell morphology in VSMCs. We demonstrate that siRNA-mediated depletion of either SUN1 or SUN2 altered VSMC spreading and impaired actomyosin activity and RhoA activity. Importantly, these findings were recapitulated using aortic VSMCs isolated from wild-type and SUN2 knockout (SUN2 KO) mice. Inhibition of actomyosin activity, using the rho-associated, coiled-coil-containing protein kinase1/2 (ROCK1/2) inhibitor Y27632 or blebbistatin, reduced SUN2 mobility in the nuclear envelope and decreased the association between SUN2 and lamin A, confirming that SUN2 dynamics and interactions are influenced by actomyosin activity. We propose that the LINC complex exists in a mechanical feedback circuit with RhoA to regulate VSMC actomyosin activity and morphology.

show abstract

“…How could SUN2 LINC complexes influence sarcomere contractile function? Beyond its direct interactions with the actin cytoskeleton, the LINC complex is implicated as a regulator of RhoA activity (Thakar et al, 2017), interacts with other modulators of actin organization and function, such as the formin FHOD1 in fibroblasts (Kutscheidt et al, 2014), and is known to influence actin dynamics (Lammerding et al, 2004;Lee et al, 2007;Hale et al, 2008;Stewart-Hutchinson et al, 2008;Khatau et al, 2009;Luxton et al, 2010b;Folker et al, 2011;Kim et al, 2012). However, it should be noted that while increased cardiac contractility at the organ-level is frequently observed in HCM, cell autonomous hypercontractility is not always observed in these disease models (Moore et al, 2012).…”

Section: Discussionmentioning

confidence: 99%

Ablation of SUN2-containing LINC complexes drives cardiac hypertrophy without interstitial fibrosis

Stewart

Rodriguez

King

2019

Preprint

View full text Add to dashboard Cite

Running Head: SUN2 in cardiac functionAbbreviations: LINC complex -linker of Nucleoskeleton and Cytoskeleton ICD -intercalated disc LV -left ventricle HCM -hypertrophic cardiomyopathy qPCR -quantitative polymerase chain reaction TEM -transmission electron microscopy AbstractThe cardiomyocyte cytoskeleton, including the sarcomeric contractile apparatus, forms a cohesive network with cellular adhesions at the plasma membrane and nuclear-cytoskeletal linkages (LINC complexes) at the nuclear envelope. Human cardiomyopathies are genetically linked to the LINC complex and A-type lamins, but an full understanding of disease etiology in these patients is lacking. Here we show SUN2-null mice display cardiac hypertrophy coincident with enhanced AKT/MAPK signaling, as has been described previously for mice lacking A-type lamins. Surprisingly, in contrast to lamin A/C-null mice, SUN2-null mice fail to show coincident fibrosis or upregulation of pathological hypertrophy markers. Thus, cardiac hypertrophy is uncoupled from pro-fibrotic signaling in this mouse model, which we tie to a requirement for the LINC complex in productive TGFβ signaling. In the absence of SUN2, we detect elevated levels of the integral inner nuclear membrane protein MAN1, an established negative regulator of TGFβ signaling, at the nuclear envelope. We suggest that A-type lamins and SUN2 play antagonistic roles in the modulation of pro-fibrotic signaling through opposite effects on MAN1 levels at the nuclear lamina, suggesting a new perspective on disease etiology.Sarcomere disorganization precedes changes in nuclear morphology in Sun2-/-mice (Roche) according to manufacturer's instructions and repurified using the RNeasy kit (QIAGEN). To generate cDNA, equal amounts of digested total RNA (1 μg) were added to SuperScript III Reverse Transcriptase (Invitrogen) reactions using Random Primer 9 (New England Biolabs). Quantitative real-time PCR was conducted with a Bio-Rad CFX96 Real-Time System using the iQ SYBR Green Supermix (Bio-Rad) for 39 cycles. Primers used in these experiments were: ANP forward: CAAGATGCAGAAGCTGCTGG and reverse: GTGCTGCCTTGAGACCGAAGG; BNP forward: GTTTGGGCTGTAACGCACTGA and reverse: GAAAGAGACCCAGGCAGAGTCA; Skeletal α-actin forward: CATGAAGATCAAGATCATCGC and reverse: CTGGAAGGTGGACAGCGAGGC; Serca2 forward: GTGTGGCAGGAAAGAAATGC and reverse: CCAGGAACTATGTCTTTAGC; FN1 forward: TTCAAGTGTGATCCCCATGAAG and reverse: CAGGTCTACGGCAGTTGTCA; COL1A1 forward: CTGGCGGTTCAGGTCCAAT and reverse: TTCAGGCAATCCAGAGC; COL3A1 forward: CTGTAACATGGAAACTGGGGAAA and ereverse: CCATAGCTGAACTGAAAACCACC; POSTN forward: CCTGCCCTTATATGCTCTGCT and reverse: AAACATGGTCAATAGGCATCACT; LTBP2 forward: GCTCACCGGGAGAAATGTCTG and reverse: CAGGTTTGATACAGTGGTTGGT; LOXL1 forward: GAGTGCTATTGCGCTTCCC and reverse: GGTTGCCGAAGTCACAGGT; FLNA forward: GGCTACGGTGGGCTTAGTC and reverse: GTGGGACAGTAGGTGACCCT; DES forward: TACACCTGCGAGATTGATGC and reverse: ACATCCAAGGCCATCTTCAC; GAPDH forward: CGTAGACAAAATGGTGAAGGTCGG and reverse: AAGCAGTTGGTGGTGCAGGATG; and PPIA forward: GAGCTGTTTGCAGACAAA...

show abstract

Opposing roles for distinct LINC complexes in regulation of the small GTPase RhoA

Cited by 60 publications

References 70 publications

Substrate stiffness-dependent regulation of the SRF−Mkl1 co-activator complex requires the inner nuclear membrane protein Emerin

Substrate stiffness-dependent regulation of the SRF−Mkl1 co-activator complex requires the inner nuclear membrane protein Emerin

SUN1/2 Are Essential for RhoA/ROCK-Regulated Actomyosin Activity in Isolated Vascular Smooth Muscle Cells

Ablation of SUN2-containing LINC complexes drives cardiac hypertrophy without interstitial fibrosis

Contact Info

Product

Resources

About