Optimal Eukaryotic 18S and Universal 16S/18S Ribosomal RNA Primers and Their Application in a Study of Symbiosis

Abstract

Eukaryotic 18S ribosomal RNA (rRNA) gene primers that feature a wide coverage are critical in detecting the composition of eukaryotic microscopic organisms in ecosystems. Here, we predicted 18S rRNA primers based on consecutive conserved sites and evaluated their coverage efficiency and scope of application to different eukaryotic groups. After evaluation, eight of them were considered as qualified 18S primers based on coverage rate. Next, we examined common conserved regions in prokaryotic 16S and eukaryotic 18S rRNA sequences to design 16S/18S universal primers. Three 16S/18S candidate primers, U515, U1390 and U1492, were then considered to be suitable for simultaneous amplification of the rRNA sequences in three domains. Eukaryotic 18S and prokaryotic 16S rRNA genes in a sponge were amplified simultaneously using universal primers U515 and U1390, and the subsequent sorting of pyrosequenced reads revealed some distinctive communities in different parts of the sample. The real difference in biodiversity between prokaryotic and eukaryotic symbionts could be discerned as the dissimilarity between OTUs was increased from 0.005 to 0.1. A network of the communities in external and internal parts of the sponge illustrated the co-variation of some unique microbes in certain parts of the sponge, suggesting that the universal primers are useful in simultaneous detection of prokaryotic and eukaryotic microbial communities.

Snow algae communities in Antarctica: metabolic and taxonomic composition

“…Primers were adapted from Wang et al . () where our forward primer was a 3′ section of the first primer in their Table , with the addition of nucleotides downstream of it so the primers would have similar annealing temperatures, avoiding a run of guanines and cytosines and to avoid the possibility of forming stable secondary structures or primer dimers. Our reverse primer is the reverse complement of a section of the second listed primer in their Table .…”

Gall-forming protistan parasites infect southern bull kelp across the Southern Ocean, with prevalence increasing to the south

“…Maullinia-specific primers that would not amplify host DN A were used: Mau2F (5' ACGGGTACGAGGGACGTGGG) and Mau9R (5' TGCATCAG TGTAGCGAGCGT) (Goecke et al 2012). These primers amplified part of the 18S nuclear ribosomal gene, which is used for taxonomic identifications, descriptions of variation between populations of differing geographical origin and analyses of protist phylogenetic relationships (Pawlowski et al 2012, Hadziavdic et al 2014, Wang et al 2014). PCRs were run in an Eppendorf Mastercycler (Epgradient S) using the Maullinia Touchdown protocol of Goecke et al (2012).…”

Analysis of soil microbial communities based on amplicon sequencing of marker genes

“…In general, decent coverage is achieved between 10,000 and 100,000 reads per soil sample, depending on the complexity of the microbiome, the targeted gene, and the desired resolution. Whereas for the 16S rRNA gene, typically similarity levels of 97-99% (Poretsky et al 2014) are used to analyze bacteria or archaea on the level of Bspecies,^for micro-eukaryotes thresholds from 80 to 95% are used, when 18S rRNA genes or ITS regions are analyzed (Lentendu et al 2014;Wang et al 2014). Enzyme-coding genes sequences are often translated into amino acid sequences and compared to custom databases using tools like DIAMOND or blastP.…”