Optimization of adenovirus serotype 35 vectors for efficient transduction in human hematopoietic progenitors: comparison of promoter activities

Abstract

Adenoviral gene transfer to hematopoietic stem cells (HSCs)/ progenitors would provide a new approach to the treatment of hematopoietic diseases and study of the hematopoietic system. We have previously reported that an adenovirus (Ad) vector composed of whole Ad serotype 35 (Ad35), which belongs to subgroup B, shows efficient gene transfer into human bone marrow CD34 + cells. However, Ad35 vector-mediated transduction into human HSCs/progenitors has not yet been fully optimized. In the present study, we have systematically examined promoter activity in the context of Ad35 vectors in human bone marrow CD34 + cells and primitive CD34 + subsets to optimize the transduction efficiency in human hematopoietic stem/progenitor cells. In the first of the transduction experiments, the improved in vitro ligation method was applied to Ad35 vector construction to allow for simple and efficient production of an E1/E3-deleted Ad35 vector. Using this method, we constructed a series of Ad35 vectors encoding the enhanced green fluorescence protein (GFP) under the control of a variety of strong viral and cellular promoters. Of the six types of promoters tested, significantly higher transduction efficiencies were achieved with the human elongation factor 1a promoter (EF1a promoter), the human cytomegalovirus (CMV) immediateearly 1 gene enhancer/b-actin promoter with b-actin intron (CA promoter), and the CMV promoter/enhancer with the largest intron of CMV (intron A) (CMVi promoter) in the human CD34 + cells and the immature subsets (CD34 + CD38 low/À and CD34 + AC133 + subsets). In particular, the CA promoter was found to allow for the highest transduction efficiencies in both the whole human CD34 + cells and the immature hematopoietic subsets. Furthermore, the CA promoter-mediated GFP-expressing cells differentiated into progenitor cells of all lineages. These results indicate the construction of an optimized Ad35 vector backbone for efficient transduction into HSCs/progenitors.

Interaction of penton base Arg-Gly-Asp motifs with integrins is crucial for adenovirus serotype 35 vector transduction in human hematopoietic cells

“…Quantitative real-time PCR was performed as described previously. 23 In transduction-blocking experiments using the RGD peptide, human CD34 + cells and K562 cells were incubated with Ad35GFP at 4 or 37 1C in the presence of 200 mg ml À1 of the RGD peptide for 3 h (CD34 + cells) or 1.5 h (K562 cells) as described above. Following incubation, the cells were washed and the vector genome numbers were measured by real-time PCR analysis, as described above.…”

“…23,39,40 GFP-expressing Ad35 vector plasmids (pAdMS18CA-GFP, pAdMS19CA-GFP and pAdMS20CA-GFP) were constructed by ligation of I-CeuI/PI-SceIdigested pAdMS18, pAdMS19 and pAdMS20, respectively, and I-CeuI/PI-SceI-digested pHMCA5-GFP. pHMCA5-GFP was constructed by insertion of the GFP gene, which was derived from pEGFP-N1 (Clontech, Mountain View, CA, USA) into pHMCA5.…”

“…pFS2-Ad35-12 was cut by SnaBI and PacI, and ligated with oligonucleotides 1 (5 0 -TAACTATAACGGTC CTAAGGTAGCGAATTTAAATATCTATGTCGGGTGCG GAGAAAGAGGTAATGAAATGGCAAT-3 0 ) and 2 (5 0 -T GCCATTTCATTACCTCTTTCTCCGCACCCGACATAG ATATTTAAATTCGCTACCTTAGGACCGTTATAGTTA-3 0 ) (I-CeuI, SwaI and PI-SceI recognition sequences are noted by underlining, italics and bold, respectively), resulting in pFS2-Ad35-13, which contains I-CeuI, SwaI and PI-SceI sites in the E1 deletion site of the Ad35 genome. The ICeuI/AscI fragments of pFS2-Ad35-13 and pAdMS4 23 were ligated, resulting in pAdMS18. pAdMS18 has ICeuI, SwaI and PI-SceI sites in the E1 deletion region (DE1:450-2912 bp).…”

“…15,23,24 Human bone marrow-derived CD34 + cells are an important target for gene therapy, because the CD34 + cells are a fraction that contains hematopoietic stem cells. We found that inhibition of the interaction between integrins and penton base RGD motifs did not alter total amounts of cell-associated vector DNA of Ad35 vectors at 4 or 37 1C; however, it significantly reduced the transduction efficiencies of Ad35 vectors, suggesting that interaction between integrins and penton base RGD motifs is largely involved with Ad35 vector-mediated transduction, probably in postinternalization steps.…”

Efficient antitumor effects of carrier cells loaded with a fiber-substituted conditionally replicating adenovirus on CAR-negative tumor cells

“…[19][20][21] Briefly, pShuttle2-PL/hMKpro þ E1A-E1B, 22 which possesses the E1A and E1B gene under the control of the midkine promoter, 23 was digested with I-CeuI/PI-SceI and ligated with the I-CeuI/PI-SceIdigested pAdHM3. 20 The resulting plasmid, pAdHM3-hMKpro, was transfected into 293 cells using the Superfect transfection reagent after digestion with PacI in order to generate a conventional CRAd based on Ad5 (CRAd-F5).…”