Optimization of long-range PCR protocol to prepare filaggrin exon 3 libraries for PacBio long-read sequencing

Abstract

Background The filaggrin (FLG) protein, encoded by the FLG gene, is an intermediate filament-associated protein that plays a crucial role in the terminal stages of human epidermal differentiation. Loss-of-function mutations in the FLG exon 3 have been associated with skin diseases. The identification of causative mutations is challenging, due to the high sequence homology within its exon 3 (12,753 bp), which includes 10 to 12 filaggrin tandem repeats. With this study we aimed to obtain the whole FLG exon 3 sequence through PacBio technology, once 13-kb amplicons have been generated. Methods and results For the preparation of SMRTbell libraries to be sequenced using PacBio technology, we focused on optimizing a 2-step long-range PCR protocol to generate 13-kb amplicons covering the whole FLG exon 3 sequence. The performance of three long-range DNA polymerases was assessed in an attempt to improve the PCR conditions required for the enzymes to function properly. We focused on optimization of the input template DNA concentration and thermocycling parameters to correctly amplify the entire FLG exon 3 sequence, minimizing non-specific amplification. Conclusions Taken together, our findings suggested that the PrimeSTAR protocol is suitable for producing the amplicons of the 13-kb FLG whole exon 3 to prepare SMRTbell libraries. We suggest that sequencing the generated amplicons may be useful for identifying LoF variants that are causative of the patients’ disorders.

Improving Yields in Multi-analyte Extractions by Utilizing Post-homogenized Tissue Debris

“…14 Long-range PCR demonstrated that 15-kbp amplicons could be generated from the DNA extracts, indicating amenability to sequencing. 15,16 Improved yields and higher DNA integrity with Puregene compared with QIAamp have both been demonstrated before. [17][18][19] The difference between the two kits in respect of DNA yield was extensive, both in the initial study using 11 blocks per method and in the validation cohort.…”

“…We numbered the bands such that each band number represented a band of distinct molecular mass that was unique to a tissue block, but which could be present in more than one homogenization of that tissue block. There were a total of 127 bands numbered [mean, 17.5 per block (range, [14][15][16][17][18][19][20][21][22]], of which 5.5 % were only detected in homogenization 2, 5.5% only in homogenization 3, and 3.1% only in homogenization 4. Most were present in all three homogenizations (73 % of the total, n=93), and the remainder were in two homogenizations only (Fig.…”

Filaggrin loss-of-function variants are associated with atopic dermatitis phenotypes in a diverse, early-life prospective cohort

“…We initially identified 5 children in this study with 2 or more FLG LoF variants according to the genotype calls based upon short-read sequencing (Table 2). To determine the chromosome phase of these variants and identify those children with compound heterozygous FLG LoF variants, we performed long-read sequencing on DNA following PCR enrichment of exon 3 as previously published (21). The analysis of these sequences validated 3 children with compound heterozygous FLG LoF variants (Figure 1, C-E, and Table 2).…”

“…Five individuals (out of 438) in this study were determined to have 2 or more heterozygous FLG LoF variants via short-read sequencing. To validate phase and genotype for these 5 samples, DNA from blood was extracted as described above, and a published protocol was used to PCR-amplify exon 3 for long-read sequencing (21). Briefly, the first PCR reaction used forward: 5′TGGGACAGTGATTATGTTGGAGA3′ and reverse: 5′AGGGTTATTTT-GAGCTCTTTGTGAA3′ primers to amplify a 12-kilobase region that was then amplified in a second nested PCR reaction with forward primer: 5′GGCGCAGACTGTCCATGGGT3′ and reverse primer: 5′TCG-GCAAATCCTGAAGGTAAGAGTC3′.…”

Towards a Long-Read Sequencing Approach for the Molecular Diagnosis of RPGRORF15 Genetic Variants

“…The SMRTbell library to sequence RPGR ORF15 was prepared following the PacBio protocol guidelines Procedure & Checklist-Preparing SMRTbell ® Libraries using PacBio ® Barcoded Universal Primers for Multiplexing Amplicons-Part Number 101-791-800 Version 02 (April 2020) [26]. All assays were performed as already described in our publication [27].…”