Optimized Pan-species and Speciation Duplex Real-time PCR Assays for Plasmodium Parasites Detection in Malaria Vectors

Abstract

BackgroundAn accurate method for detecting malaria parasites in the mosquito’s vector remains an essential component in the vector control. The Enzyme linked immunosorbent assay specific for circumsporozoite protein (ELISA-CSP) is the gold standard method for the detection of malaria parasites in the vector even if it presents some limitations. Here, we optimized multiplex real-time PCR assays to accurately detect minor populations in mixed infection with multiple Plasmodium species in the African malaria vectors Anopheles gambiae and Anopheles funestus.MethodsComplementary TaqMan-based real-time PCR assays that detect Plasmodium species using specific primers and probes were first evaluated on artificial mixtures of different targets inserted in plasmid constructs. The assays were further validated in comparison with the ELISA-CSP on 200 field caught Anopheles gambiae and Anopheles funestus mosquitoes collected in two localities in southern Benin.ResultsThe validation of the duplex real-time PCR assays on the plasmid mixtures demonstrated robust specificity and sensitivity for detecting distinct targets. Using a panel of mosquito specimen, the real-time PCR showed a relatively high sensitivity (88.6%) and specificity (98%), compared to ELISA-CSP as the referent standard. The agreement between both methods was “excellent” (κ = 0.8, P<0.05). The relative quantification of Plasmodium DNA between the two Anopheles species analyzed showed no significant difference (P = 0, 2). All infected mosquito samples contained Plasmodium falciparum DNA and mixed infections with P. malariae and/or P. ovale were observed in 18.6% and 13.6% of An. gambiae and An. funestus respectively. Plasmodium vivax was found in none of the mosquito samples analyzed.ConclusionThis study presents an optimized method for detecting the four Plasmodium species in the African malaria vectors. The study highlights substantial discordance with traditional ELISA-CSP pointing out the utility of employing an accurate molecular diagnostic tool for detecting malaria parasites in field mosquito populations.

Evidence of a multiple insecticide resistance in the malaria vector Anopheles funestus in South West Nigeria

“…The 8% infection rate observed in Akaka-Remo is similar to high levels of infection rates recorded previously for An. funestus across the continent such as the 20% [24] and 50% [40] observed in Burkina Faso, the 13.6% [41] and 18% [26] observed in Benin and 12.5% in Ghana [42]. Although, some of the variations between these rates could be down to the differences in the methods used (TaqMan, ELISA and Nested-PCR) and the consistent high levels support a high vectorial capacity of An.…”

Insecticide Resistance Alleles Affect Vector Competence of Anopheles gambiae s.s. for Plasmodium falciparum Field Isolates

“…For P. falciparum quantification, the 18S rDNA gene was amplified from 3D7 gDNA (MR4) using outer primers of the Nested PCR described by Snounou et al . [38], [39] and cloned into the pGEM-T vector (Promega) and verified by sequencing [40]. The mosquito gene S7 was amplified as a positive control to ensure that the DNA from the sample was successfully extracted and to later allow normalization when comparing strains and replicates.…”

“…The mosquito gene S7 was amplified as a positive control to ensure that the DNA from the sample was successfully extracted and to later allow normalization when comparing strains and replicates. Specific primers and a corresponding TaqMan probe (FS7: CCAGGATGGCATCGTACAC; RS7: CGCGAGTTGGAGAAGAAGTT; S7probe: VIC–GCGCTCGGCAATGAACACGA-TAMRA) were designed and validated on a serial dilution standard of purified PCR products from the Anopheles gambiae s.s. gDNA (efficiency = 99%) [40]. The purified PCR product (396 bp) copy number quantification was performed by spectrophotometric analysis.…”

High rates of parasite recrudescence following intermittent preventive treatment with sulphadoxine-pyrimethamine during pregnancy in Benin

“…Malaria transmission is perennial, with two peaks during the two rainy seasons. The entomological inoculation rate (EIR) ranges from 35 to 60 infective bites per person and per year [23], with P. falciparum predominating [24]. The study area has been described elsewhere [25].…”