Optimizing CRISPR/Cas9-based gene manipulation in echinoderms

Oulhen, Nathalie; Pieplow, Cosmo; Perillo, Margherita; Gregory, Pauline; Wessel, Gary M.

doi:10.1016/j.ydbio.2022.07.008

Cited by 11 publications

(15 citation statements)

References 22 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…This showed, in case of RNPs, the mutation efficiency is 68.3 ± 26.5 %, while the transcribed Cas9 and guides produced 61 ± 13 % editing. This is in keeping with other work in echinoderms, for example editing efficiency from sea urchin Alx1 promoter mutagenesis experiments using Cas9 mRNA with "home-made" guide RNAs were 53 and 69.2% (Pieplow et al, 2021); in case of RNPs targeting sea urchin FoxY, the mutation rate was 71% (Oulhen et al, 2022).…”

Section: Discussionsupporting

confidence: 89%

“…Taken together, our data show that doxycycline-dependent Cas9 induction in vivo (Figure 2D) induces target gene alterations that can recapitulate the effect of the most effective traditional in vitro complexed RNPs knockout approaches (Figure 2A, (Oulhen et al, 2022)). Hence strategies that restrict Tet-ON 3G (rtTA) (Figure 1A) to defined tissue provide a means to produce tissue/cell specific gene disruption.…”

Section: Resultssupporting

confidence: 54%

“…CRISPR/Cas9 - based genome editing was recently successfully applied in echinoderm (Lin et al, 2019; Oulhen et al, 2022), which represents a major step towards more sophisticated genetic manipulation, and the establishment of reproducible transgenic adult lines. Before CRISPR technological era the genetic perturbation studies in echinoderm biology heavily rely on using MASO (morpholino antisense oligonucleotides) knockdowns, which are not long lasting and therefore do not perturb gene expression during post embryonic and adult stages.…”

Section: Introductionmentioning

confidence: 99%

See 2 more Smart Citations

Induciblein vivogenome editing in the sea starPatiria miniata

Zueva

Hinman

2023

Preprint

View full text Add to dashboard Cite

For centuries, echinoderms, a marine-invertebrate phylum, have fascinated scientists for their developmental and postembryonic phenomen. Experimentation on their eggs and embryos in particular have contributed foundation scientific advances. However, powerful molecular genetic studies are restricted to embryonic developmental stages which are amenable to genetic perturbation by microinjection of reagents into the zygotes. This represents a significant bottleneck to the study of postembryonic processes in where the earliest function of a gene must remain intact. We therefore sought to establish a spatio-temporal turnable gene editing tool for these species. Here, using the sea star Patiria miniata as a model we introduce a chemically inducible, Tet-ON, gene expression system. Pairing this Tet-ON system with CRISPR-mediated gene alteration technology we show as a proof-of-principle demonstration an inducible gene editing in the sea star transgenic cell populations for the first time in echinoderm biology. The approach we show here can be adapted for use in other species of echinoderms and will also extend experimental possibilities tremendously.

show abstract

Section: Discussionsupporting

confidence: 89%

Section: Resultssupporting

confidence: 54%

Section: Introductionmentioning

confidence: 99%

See 1 more Smart Citation

Induciblein vivogenome editing in the sea starPatiria miniata

Zueva

Hinman

2023

Preprint

View full text Add to dashboard Cite

show abstract

“…Mutations of the gene encoding PKS1 by CRISPR knockout resulted in albino larvae, an easy phenotype to assess with simple brightfield microscopy (Oulhen & Wessel, 2016a). A single gRNA was previously shown to mutate PKS1 by Cas9 activity, nearly 100% of the time in embryos from S. purpuratus and Hemicentrotus pulcherrimus (Liu et al, 2019; Oulhen & Wessel, 2016a; Oulhen et al, 2022). We took advantage of this highly efficient gRNA to test and to optimize Cas9‐mediated methodology in the sea urchin S. purpuratus .…”

Section: Figurementioning

confidence: 99%

CRISPR/Cas9 knockin methodology for the sea urchin embryo

Oulhen

Morita

Warner

et al. 2023

Molecular Reproduction Devel

Self Cite

View full text Add to dashboard Cite

“…Pm_Fz1/2/7: 27_ACGGTGTGGGCCGTGAAATC; 81_TCTGCGGTCGAATGTCAAAT; 200_CAGACAGGAGGAAGCCGGCT. Genomic DNA of individual larvae was sequenced to test for CRISPR Cas9 induced mutations as previously described (Oulhen et al, 2022). Genomic sequences used to find Patiria miniata genes and to design gRNAs were analyzed with the resources at echinobase.org (Arshinoff et al, 2021).…”

Section: Perturbation Experiments With Maso Injection and Crispr Cas9mentioning

confidence: 99%

Molecular mechanisms of tubulogenesis revealed in the sea star hydro-vascular organ

Perillo

Swartz

Pieplow

et al. 2022

Preprint

Self Cite

View full text Add to dashboard Cite

A fundamental goal in the organogenesis field is to understand how cells organize into tubular shapes. Toward this aim, we have established the hydro-vascular organ in the sea star Patiria miniata as a model for tubulogenesis. In this animal, bilateral tubes grow out from the tip of the developing gut, and precisely extend to specific sites in the larva. This growth requires cell migration coupled with mitosis in distinct zones. Cell proliferation requires FGF signaling, whereas the three-dimensional orientation of the organ depends on Wnt signaling. Specification and maintenance of tube cell fate requires Delta/Notch signaling. Moreover, we identify target genes of the FGF pathway that contribute to tube morphology, revealing molecular mechanisms for tube outgrowth. Finally, we report that FGF activates the Six1/2 transcription factor, which serves as an evolutionarily ancient regulator of branching morphogenesis. This study uncovers novel mechanisms of tubulogenesis in vivo and we propose that cellular dynamics in the sea star hydro-vascular organ represents a key comparison for understanding the evolution of vertebrate organs.

show abstract

Optimizing CRISPR/Cas9-based gene manipulation in echinoderms

Cited by 11 publications

References 22 publications

Induciblein vivogenome editing in the sea starPatiria miniata

Induciblein vivogenome editing in the sea starPatiria miniata

CRISPR/Cas9 knockin methodology for the sea urchin embryo

Molecular mechanisms of tubulogenesis revealed in the sea star hydro-vascular organ

Contact Info

Product

Resources

About