Osteocyte RANKL Drives Bone Resorption in Mouse Ligature-Induced Periodontitis

Abstract

Mouse ligature‐induced periodontitis (LIP) has been used to study bone loss in periodontitis. However, the role of osteocytes in LIP remains unclear. Furthermore, there is no consensus on the choice of alveolar bone parameters and time points to evaluate LIP. Here, we investigated the dynamics of changes in osteoclastogenesis and bone volume (BV) loss in LIP over 14 days. Time course analysis revealed that osteoclast induction peaked on days 3 and 5, followed by the peak of BV loss on day 7. Notably, BV was restored by day 14. The bone formation phase following the bone resorption phase was suggested to be responsible for the recovery of bone loss. Electron microscopy identified bacteria in the osteocyte lacunar space beyond the periodontal ligament (PDL) tissue. We investigated how osteocytes affect bone resorption of LIP and found that mice lacking receptor activator of NF‐κB ligand (RANKL), predominantly in osteocytes, protected against bone loss in LIP, whereas recombination activating 1 (RAG1)‐deficient mice failed to resist it. These results indicate that T/B cells are dispensable for osteoclast induction in LIP and that RANKL from osteocytes and mature osteoblasts regulates bone resorption by LIP. Remarkably, mice lacking the myeloid differentiation primary response gene 88 (MYD88) did not show protection against LIP‐induced bone loss. Instead, osteocytic cells expressed nucleotide‐binding oligomerization domain containing 1 (NOD1), and primary osteocytes induced significantly higher Rankl than primary osteoblasts when stimulated with a NOD1 agonist. Taken together, LIP induced both bone resorption and bone formation in a stage‐dependent manner, suggesting that the selection of time points is critical for quantifying bone loss in mouse LIP. Pathogenetically, the current study suggests that bacterial activation of osteocytes via NOD1 is involved in the mechanism of osteoclastogenesis in LIP. The NOD1‐RANKL axis in osteocytes may be a therapeutic target for bone resorption in periodontitis.This article is protected by copyright. All rights reserved.

Inhibition of RANKL improves the skeletal phenotype of adenine-induced chronic kidney disease in mice

“…Primers used for genotyping are Rankl_fl_F2: CTGGGAGCGCAGGTTAAATA 19 ; 15 251 Rankl_fl_R1: AGCTTTTAGAATGCCAATAATTAAA (Jax); Rankl_fl_R2: GTCTAGGATAATGCACGGCACC. 20 At 15 wk of age, half of the Con and cKO mice of each sex were assigned a control diet (CD) and were switched from the facility-provided grain-based diet to a purified casein-based diet with an adjusted calcium and phosphorus ratio with 0.9% phosphorous and 0.6% calcium (Teklad Diets [%TD.150303]; Inotiv). The remaining half of the Con and cKO mice were assigned adenine diet (AD) to induce CKD with the same casein-based diet with an addition of 0.2% adenine for 6 wk (Teklad Diets [TD.170948]; Inotiv).…”

Loss-of-function OGFRL1 variants identified in autosomal recessive cherubism families

“…Jawbones with tooth root fusion in the second molar were excluded from the analysis. 18 For linear analysis, the total distance between cementoenamel junction and alveolar bone crest (CEJ-ABC distance) underneath the 4 cusps of the second molar was measured. For calvarial bone analysis, a threshold value of 48 was used.…”