Overexpression of an archaeal protein in yeast: Secretion bottleneck at the ER

Abstract

Archaeal enzymes have great potential for industrial use; however, expressing them in their natural hosts has proven challenging. Growth conditions for many archaea are beyond typical fermentation capabilities, and to compound the problem, archaea generally achieve much lower biomass yields than Escherichia coli or Saccharomyces cerevisiae. To determine whether a eukaryotic host, S. cerevisiae, would be a suitable alternative for archaeal protein production, we examined the expression of the tetrameric beta-glucosidase from the hyperthermophilic archaeon Pyrococcus furiosus. We engineered the beta-glucosidase to facilitate secretion into the culture medium and have demonstrated the beta-glucosidase's secretion and activity. We determined the dependence of beta-glucosidase secretion on gene copy number and obtained a transformant capable of secreting approximately 10 mg/L in batch culture. All transformants retained large intracellular fractions of beta-glucosidase, indicative of an intracellular bottleneck. Cell fractionation by sucrose density centrifugation and immunofluorescence identified the endoplasmic reticulum as the secretion bottleneck. Preliminary evidence indicates that the cause of this bottleneck is misfolding of the monomeric beta-glucosidase, rather than tetrameric association. Expression at moderately elevated temperatures (between 30 and 40 degrees C) improved beta-glucosidase yields, suggesting that higher temperature expression may improve folding and secretion yields.

A Yeast Platform for the Production of Single-Chain Antibody-Green Fluorescent Protein Fusions

“…Secretion of heterologous proteins is often limited by various intracellular bottlenecks. The endoplasmic reticulum has often been recognized as a bottleneck for foreign-protein secretion in yeast (31,32). Manipulation of levels of ER chaperones and foldases improves secretion levels for many yeast foreign proteins, including scFv (9,28,31,33), but overexpression of ER chaperones and foldases does not always help foreign-protein secretion (30,33).…”

“…Yeast possesses a widely varied capacity for secreting heterologous proteins that ranges from no secretion of a singlechain T-cell receptor (scTCR) (15) and moderate expression of single-chain antibodies (20 mg/liter) (31) to extremely high secretion levels of bovine pancreatic trypsin inhibitor (180 mg/ liter) (22), indicating that different proteins may undergo different secretory pathway processing and encounter different secretion bottlenecks (31,32). Of particular relevance to this study, scFv and scTCR secretion in yeast can vary by several orders of magnitude, from micrograms to milligrams per liter (7,19,30,31).…”

High-level expression in Saccharomyces cerevisiae enables isolation and spectroscopic characterization of functional human adenosine A2a receptor

“…pITy4-β (Smith and Robinson, 2002) was digested with AflII and EagI restriction enzymes in order to remove the β-glucosidase gene, and the empty plasmid was recovered through gel extraction using a PCR-cleanup kit (Promega, Madison, WI). Complementary oligonucleotides containing the sequence 5′-CGGCCGGACGTCCCGCGGCACGTGTCATCACATCATCATCATCATCATCAT CATCATCATTAATAACCTTAAG-3′ were obtained from Operon (Huntsville, AL) and annealed together for 1 minute at 90°C and then allowed to cool at room temperature for 1 hour.…”

Enhancement of protein secretion inPichia pastoris by overexpression of protein disulfide isomerase

“…Standard steps to improve recombinant protein expression include optimizing codon usage and increasing the gene dosage. However, overexpression of a protein in a nonoptimal environment may cause deleterious problems, such as saturation of the secretory pathway resulting in by misfolded proteins (Inan et al, 2005;Parekh et al, 1995;Smith and Robinson, 2002). The folding of proteins destined for the secretory pathway occurs in the endoplasmic reticulum (ER) where a quality control system insures that secreted proteins are correctly folded, including the correct formation of disulfide bonds (Helenius et al, 1992).…”