Overexpression of vacuolar H+-ATPase-related genes in bottom-fermenting yeast enhances ethanol tolerance and fermentation rates during high-gravity fermentation

Abstract

Vacuolar H+ -ATPase (V-ATPase) is thought to play a role in stress tolerance. In this study it was found that bottom-fermenting yeast strains, in which the V-ATPase-related genes DBF2, VMA41/CYS4/NHS5 and RAV2 were overexpressed, exhibited stronger ethanol tolerance than the parent strain and showed increased fermentation rates in a high-sugar medium simulating highgravity fermentation. Among the strains examined, the DBF2-overexpressing bottom-fermenting yeast strain exhibited the highest ethanol tolerance and fermentation rate in YPM20 medium. Using this strain, high-gravity fermentation was performed by adding sugar to the wort, which led to increased fermentation rates and yeast viability compared with the parent strain. These findings indicate that V-ATPase is a stress target in high-gravity fermentation and suggests that enhancing the V-ATPase activity increases the ethanol tolerance of bottom-fermenting yeast, thereby improving the fermentation rate and cell viability under high-gravity conditions.

High gravity primary continuous beer fermentation using flocculent yeast biomass

“…Although (together with other stress factors) the ethanol stress might have discouraged biomass growth ( μ max = 0.013/h), evidence reported by Hasegawa et al . may support the good performance of fermentation rates for the current setup.…”

“…As fermentation in this work ran in a continuous mode, sugar levels inside the airlift reactor were low owing to the quick uptake of nutrients by the large amount of X tot in the reactor; on the other hand the ethanol concentration was always around 52 ± 3 g/L. Although (together with other stress factors) the ethanol stress might have discouraged biomass growth (μ max = 0.013/h), evidence reported by Hasegawa et al (30) may support the good performance of fermentation rates for the current setup.…”

“…Although high osmolarity has been targeted as being one of the main stress factors during HGB , ethanol tolerance developed by lager yeast strains was recently observed to increase fermentation rates . As fermentation in this work ran in a continuous mode, sugar levels inside the airlift reactor were low owing to the quick uptake of nutrients by the large amount of X tot in the reactor; on the other hand the ethanol concentration was always around 52 ± 3 g/L.…”

Characterization of dimethyl sulphoxide reductase from brewing yeast

“…Expression levels of DMSO reductase were assayed by primers as MXR1 (forward: 5′‐TTGCGGAGG TTTTACAAGTATC‐3; and reverse: 5′‐GCATCTGA ATGAGCGAACAA‐3′) or MXR1‐CA (forward: 5′‐TGCGTGCCCTACTCACTATTT G‐3′; and reverse: 5′‐AATGGCCTTGCCTTTCC‐3′). Expression levels of housekeeping gene as control were by primers as TAF10 (forward: 5′‐CCAGGATCAGGTCTTCCGTA‐3′; and TAF10 reverse: 5′‐CAACAG CGCTACTGAGATCG‐3′) . The data was calculated using the method .…”

Comprehensive analysis of genes involved in the oxidative stress tolerance using yeast heterozygous deletion collection

“…Our results also show that heterozygous deletions of the genes encoding the components of V‐ATPase, such as VMA3 , VMA8, and VMA13 , resulted in hypersensitivity to H 2 O 2 . Thus, our study supports the emerging role of V‐ATPase in oxidative stress tolerance and the potency of V‐ATPase activity for the breeding of yeasts with high fermentation ability (Hasegawa et al ., ).…”