Overproduction, Purification, and Diagnostic Use of the Recombinant HIV‐1 Gag Proteins, the Precursor Protein p55 and the Processed Products p17, p24, and p15

Abstract

HIV-1 Gag protein precursor p55, and its processed products, p17, p24, and p15 were overproduced in Escherichia coli and purified to near homogeneity. To study the antigenic properties and the potentiality as the diagnostic and prognostic reagents, varying amounts of the purified Gag proteins were dotted onto the polyvinylidene difluoride membrane and reacted with 40 sera of HIV-1-infected individuals (35 AC, 1 ARC, and 4 AIDS patients) and 10 sera of normal healthy donors. p55 reacted with 40 (100%) sera of HIV-1 carriers, while p17, p24, and p15 reacted with 37 (92.5%), 35 (87.5%) and 34 (85%) of the 40 sera of HIV-1 carriers, respectively. On the whole, the reaction of p55 was especially strong and that of p15 was the weakest. p55 showed the strongest reaction among the four Gag proteins with all specimens, and it showed a positive reaction with a carrier serum with which none of the processed Gag proteins showed a positive reaction. Therefore, p55 is the most useful antigen among the four Gag proteins for detection of the Gag antibodies and may even be one of the most useful antigens for the diagnosis of HIV-1 infection.

Gag-Derived Proteins of HIV-1 Isolates from Indian Patients: Cloning, Expression, and Purification of p17 of B- and C-Subtypes

“…There have been a few reports on expression and purification of p17 of B-subtype, where p17 has been expressed as fusion protein (19,20,21) with only one report describing purification of p17 in unfused form (5). The methods employed in these reports for extraction and purification are cumbersome involving multiple column chromatography steps and removal of the fusion tag using proteases.…”

“…5Ј primer p172105 (5Ј GAAGGAGACATATGGand purification of p17 of HIV-1 B-subtype (5,19). p17 is generally expressed as fusion protein with glutathi-GTGCGCGTGCGTCAGTATTAAG 3Ј) and 3Ј primer P172103 (5Ј GATGTTCTGAATTCATTAGTAATTTTGone S-transferase-Sepharose (20), maltose-binding protein (21), or (His) 10 Tag (19).…”

“…Gag and protease using a T7-promoter-based expresmatrix domain of gag precursor is cotranslationally modified at the N-terminus by attachment of a myristic sion system (5). p17 was purified from cytosolic fraction using conventional chromatographic techniques.…”