Ovine dinucleotide repeat polymorphism at the MAF18 locus

Crawford, A. M.; Buchanan, Fiona; Swarbrick, P. A.

doi:10.1111/j.1365-2052.1990.tb01990.x

Cited by 63 publications

(15 citation statements)

References 2 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…3). This will allow a directed coverage of the sheep genome in linkage mapping studies (103) while a full set of highly informative markers is being developed (113,114). RFLPs identified with probes for known genes give direct access to this information derived from genetic maps of other species.…”

Section: B Genetic Markersmentioning

confidence: 99%

“…The repeats, called microsatellites, are also common in both cattle (139) and sheep (113,114,139,140). The repeats, called microsatellites, are also common in both cattle (139) and sheep (113,114,139,140).…”

Section: Linkage Mappingmentioning

confidence: 99%

“…Microsatellites are randomly distributed across the genome, and some are associated with functional genes (139). Sheep microsatellites (113,114,140) have been screened for linkage to the Fec B gene in half-sib pedigrees with no evidence of genetic linkage (A. M. Crawford, unpublished observations). Sheep microsatellites (113,114,140) have been screened for linkage to the Fec B gene in half-sib pedigrees with no evidence of genetic linkage (A. M. Crawford, unpublished observations).…”

Section: Linkage Mappingmentioning

confidence: 99%

See 2 more Smart Citations

Physiology and Molecular Genetics of Mutations that Increase Ovulation Rate in Sheep

1992

View full text Add to dashboard Cite

Section: B Genetic Markersmentioning

confidence: 99%

Section: Linkage Mappingmentioning

confidence: 99%

Section: Linkage Mappingmentioning

confidence: 99%

See 1 more Smart Citation

Physiology and Molecular Genetics of Mutations that Increase Ovulation Rate in Sheep

1992

View full text Add to dashboard Cite

“…Ovine microsatellite loci MAF18, MAF35, MAF45 and MAF65 were identified at the AgResearch Molecular Biology Unit, University of Otago, New Zealand (Crawford et a!., 1990;Swarbrick et a!., 1991Swarbrick et a!., , 1992Buchanan et a!., 1992), and primers were donated by F. Buchanan and A. Crawford. Microsatellite locus BOVIRBP was derived from the downstream noncoding region of the bovine interphotoreceptor retinoid-binding protein gene (Borst et al, 1989).…”

Section: Identification Of Microsateiite Locimentioning

confidence: 99%

Extensive protein and microsatellite variability in an isolated, cyclic ungulate population

1995

View full text Add to dashboard Cite

We investigated polymorphism at protein and microsatellite DNA loci in an isolated, umnanaged and cyclic population of Soay sheep on the island of Hirta, St. Kilda. Extensive molecular variation was revealed at both protein loci (mean heterozygosity 7.78 per cent) and microsatellite loci (mean heterozygosity 50.93 per cent). Typically, large mammals possess limited protein variation and we were surprised to observe such a level of protein heterozygosity, particularly considering the genetic history of the Hirta population. Indeed, compared to other mammals, Soay sheep lie within the top 17 per cent of the distribution of average protein heterozygosities. We discuss the level of protein heterozygosity in the context of other mammalian species, other breeds of sheep and the genetic history of Soay sheep. Possible explanations for a large average and interlocus variance in protein heterozygosity are proposed. Although little data are available from other studies to compare with microsatellite DNA variability in this population, we discuss the potential application of microsatellite markers to interpopulation and interspecific genetic studies.

show abstract

“…PCR conditions: Conditions for PCR were as previously described (Crawford et al 1990). Conditions for the amplification reaction were as follows: denaturation, 96"C, 25 s; annealing, 6 1 T , 1 min; using a Perkin Elmer Cetus (USA) thermal cycler.…”

mentioning

confidence: 99%

Ovine dinucleotide repeat polymorphism at the MAF65 locus

Buchanan

Crawford

1992

Animal Genetics

Self Cite

View full text Add to dashboard Cite

Sourceldescription:A sheep genomic fragment from a Sau3A size selected (approx. 500bp) M13mp19 library was selected by hybridization to poly(dC-dA).poly(dG-dT). The cloned fragment was designated MAF65. Sequencing of MAF65 provided the necessary information for polymerase chain reaction (PCR) primer synthesis. The dinculeotide repeat sequence within the 125-bp fragment of MAF65 was of the form (AC)*,,. The sequence of this locus has been submitted to Genbank (Accession number, M67437).Primer sequences: AAAGGCCAGAGTATGCAATTAGGAG(GT strand), CCACTCCTCCTGA-GAATATAACATG(CA strand). These primers are available from the authors' laboratory. Mendelian inheritance:Segregation was observed in 10 two-generation families containing a total of 46 individuals. The data were consistent with six codominantly inherited alleles, designated according to the number of base pairs detected in the fragment after PCR amplification. Segregation of two of these alleles is demonstrated in the pedigree shown in Fig. 1. Frequency: Estimated from 50 unrelated sheep (24 male, 26 female), from six different breeds (Romney, Merino, Coopworth, Perendale, Texel, and Finnish Landrace.) PIC = 0.62.

show abstract

Ovine dinucleotide repeat polymorphism at the MAF18 locus

Cited by 63 publications

References 2 publications

Physiology and Molecular Genetics of Mutations that Increase Ovulation Rate in Sheep

Physiology and Molecular Genetics of Mutations that Increase Ovulation Rate in Sheep

Extensive protein and microsatellite variability in an isolated, cyclic ungulate population

Ovine dinucleotide repeat polymorphism at the MAF65 locus

Contact Info

Product

Resources

About