p38 Mitogen-Activated Protein Kinase Is Activated and Linked to TNF-α Signaling in Inflammatory Bowel Disease

Abstract

Inflammatory bowel diseases (IBD)—Crohn’s disease and ulcerative colitis—are relapsing chronic inflammatory disorders which involve genetic, immunological, and environmental factors. The regulation of TNF-α, a key mediator in the inflammatory process in IBD, is interconnected with mitogen-activated protein kinase pathways. The aim of this study was to characterize the activity and expression of the four p38 subtypes (p38α–δ), c-Jun N-terminal kinases (JNKs), and the extracellular signal-regulated kinases (ERK)1/2 in the inflamed intestinal mucosa. Western blot analysis revealed that p38α, JNKs, and ERK1/2 were significantly activated in IBD, with p38α showing the most pronounced increase in kinase activity. Protein expression of p38 and JNK was only moderately altered in IBD patients compared with normal controls, whereas ERK1/2 protein was significantly down-regulated. Immunohistochemical analysis of inflamed mucosal biopsies localized the main expression of p38α to lamina propria macrophages and neutrophils. ELISA screening of the supernatants of Crohn’s disease mucosal biopsy cultures showed that incubation with the p38 inhibitor SB 203580 significantly reduced secretion of TNF-α. In vivo inhibition of TNF-α by a single infusion of anti-TNF-α Ab (infliximab) resulted in a highly significant transient increase of p38α activity during the first 48 h after infusion. A significant infliximab-dependent p38α activation was also observed in THP-1 myelomonocytic cells. In human monocytes, infliximab enhanced TNF-α gene expression, which could be inhibited by SB 203580. In conclusion, p38α signaling is involved in the pathophysiology of IBD.

N-Linked Glycosylation Is Essential for the Stability but Not the Signaling Function of the Interleukin-6 Signal Transducer Glycoprotein 130

“…Total RNA was extracted using the RNeasy mini kit (Qiagen, Hilden, Germany) according to the manufacturer's standard protocol. Reverse transcription-PCR was performed as described previously (31). The following two primer pairs were used in the same PCR: optimized sgp130Fc(-dNG), CCTGAGTTCACCT-TCACCACC (forward) and TTGTGCACCTCCACGCC (reverse), amplicon, 239 bp (to avoid amplification of endogenous gp130 transcripts, the forward primer binds to gp130 and the reverse primer binds to Fc); neomycin resistance gene in pcDNA-DEST40, GATGCCTGCTTGCCGAATATC (forward) and CGCCAAGCTCTTCAGCAATATC (reverse), amplicon, 133 bp.…”

“…Denatured whole cell extracts were produced as described previously (31). N-Glycosylation was enzymatically removed from the denatured proteins in these extracts by peptide: N-glycosidase (PNGase) F treatment (New England Biolabs, Frankfurt/Main, Germany) according to the manufacturer's instructions.…”

Systematic expression profiling of innate immune genes defines a complex pattern of immunosenescence in peripheral and intestinal leukocytes

“…The gel was immunoblotted, membranes were then blocked for an hour and incubated overnight with primary antibodies as described elsewhere. 15 Primary antibodies employed were phospho-NF-kB pp65 and NF-kB p65 (Cell Signaling Technology Inc., Danvers, MA, USA), IkB-a (Santa Cruz Biotechnology Inc., Santa Cruz, CA, USA) and b-actin used for normalization (Santa Cruz Biotechnology Inc.). After being washed with Tween-Tris-buffered saline (three times 5 min) membranes were incubated for 60 min with a horseradish peroxidase-conjugated secondary antibody (antirabbit or antimouse (both from Amersham Biosciences, Piscataway, NJ, USA)) diluted in blocking buffer.…”

G Protein-Coupled Receptor 43 Is Essential for Neutrophil Recruitment during Intestinal Inflammation

“…Phosphorylation of p38 MAPK, which has been described as a major determinant contributing to chemotaxis (24), is, among other immune cells such as macrophages, also significantly enhanced in PMNs (25) and contributes to chemotaxis of PMNs in vitro (26). Inhibition of p38 MAPK has been propagated as an experimental IBD therapy in clinical trials.…”