Pain Related Channels Are Differentially Expressed in Neuronal and Non-Neuronal Cells of Glabrous Skin of Fabry Knockout Male Mice

Lakomá, Jarmila; Rimondini, Roberto; Donadio, Vincenzo; Liguori, Rocco; Caprini, Marco

doi:10.1371/journal.pone.0108641

Cited by 47 publications

(84 citation statements)

References 70 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…Studies have proposed that the spontaneous pain episodes may be caused by hyperexcitability of nociceptive neurons mediated by upregulation of TRPV1 or Na V 1.8 (41, 42), or increased Ca 2+ influx by elevated levels of lyso-Gb3 (15, 16). Although our results do not support increased mRNA levels of TRPV1 and Na V 1.8, these channels may be post-transcriptionally regulated (41, 42). Furthermore, our recordings of voltage-gated Ca 2+ channels were performed in the absence of exogenous Gb3 and lyso-Gb3.…”

Section: Discussionmentioning

confidence: 99%

Changes in Ionic Conductance Signature of Nociceptive Neurons Underlying Fabry Disease Phenotype

et al. 2017

View full text Add to dashboard Cite

The first symptom arising in many Fabry patients is neuropathic pain due to changes in small myelinated and unmyelinated fibers in the periphery, which is subsequently followed by a loss of sensory perception. Here we studied changes in the peripheral nervous system of Fabry patients and a Fabry mouse model induced by deletion of α-galactosidase A (Gla−/0). The skin innervation of Gla−/0 mice resembles that of the human Fabry patients. In Fabry diseased humans and Gla−/0 mice, we observed similar sensory abnormalities, which were also observed in nerve fiber recordings in both patients and mice. Electrophysiological recordings of cultured Gla−/0 nociceptors revealed that the conductance of voltage-gated Na+ and Ca2+ currents was decreased in Gla−/0 nociceptors, whereas the activation of voltage-gated K+ currents was at more depolarized potentials. Conclusively, we have observed that reduced sensory perception due to small-fiber degeneration coincides with altered electrophysiological properties of sensory neurons.

show abstract

Section: Discussionmentioning

confidence: 99%

Changes in Ionic Conductance Signature of Nociceptive Neurons Underlying Fabry Disease Phenotype

et al. 2017

View full text Add to dashboard Cite

show abstract

“…Intestinal ischaemia due myenteric vessel occlusion could also be correlated with the small fiber neuropathy as a result of vasa nervorum obliteration [4]. Animal models with FD showed mechanical hypersensitivity in the von- Frey test and mechanical allodynia when compared with controls [23], [24]. The same studies demonstrated that tissue involvement in DRG and small nerve fiber loss are linked with upregulation of sodium channels type 1.8 (Na v 1.8) and transient receptor potential vanilloid type 1 (TRPV1).…”

Section: Discussionmentioning

confidence: 99%

Chronic intestinal pseudo-obstruction. Did you search for lysosomal storage diseases?

Politei

Durand

Schenone

et al. 2017

Molecular Genetics and Metabolism Reports

View full text Add to dashboard Cite

Chronic intestinal pseudo-obstruction results in clinical manifestations that resemble intestinal obstruction but in the absence of any physical obstructive process. Fabry disease is an X-linked lysosomal storage disease characterized by the dysfunction of multiple systems, including significant gastrointestinal involvement. We report the occurrence of chronic intestinal pseudo-obstruction in two unrelated patients with Fabry disease and the possible explanation of a direct relation of these two disorders. In Fabry disease, gastrointestinal symptoms occur in approximately 70% of male patients, but the frequency ranges from 19% to 69% in different series. In some patients, colonic dysmotility due glycolipid deposition in autonomic plexus and ganglia can lead to the pseudo-obstruction syndrome, simulating intestinal necrosis. That is why up to this date colostomy has been performed in some cases, even for children with FD without cardiac, renal or cerebrovascular compromise. Early treatment with enzyme replacement therapy in asymptomatic or mildly symptomatic patients may be justified in order to prevent disease progression. Several studies have demonstrated that enzyme replacement therapy alleviates GI manifestations. Because of the non-specific nature of the gastrointestinal symptoms, diagnosis of Fabry disease is often delayed for several years. Gastrointestinal involvement is often misdiagnosed or under-reported. It is therefore very important to consider Fabry disease in the differential diagnosis of chronic intestinal pseudo-obstruction.

show abstract

“…Genomic DNA was extracted from tail biopsies and genotyped as described using the following oligonucleotides: oIMR5947 5′‐AGGTCCACAGCAAAGGATTG‐3′, oIMR5948 5′‐GCAAGTTGCCCTCTGACTTC‐3′, and oIMR7415 5′‐GCCAGAGGCCACTTGTGTAG‐3′. The PCR was carried out under the following conditions: 94°C for 3 minutes, 35 cycles of 94°C for 30 seconds, 64°C for 1 minutes, and 72°C for 1 minutes, and final elongation step of 72°C for 2 minutes.…”

Section: Methodsmentioning

confidence: 99%

“…Several lines of evidence indicate that the origin of the peripheral pain presumably lies in the accumulation of Gb3 within peripheral nerves and/or dorsal root ganglion (DRG) that might lead to degeneration of small sensory fibers . In this regard, it has been recently demonstrated that the α‐Gal A (−/0) hemizygous male mice (FD mouse model), which share many symptoms with FD patients, present molecular and structural changes in peripheral nerves which underlie pain and sensory‐perceptual alterations such as heat/cold hyperalgesia and mechano‐hyperalgesia …”

Section: Introductionmentioning

confidence: 99%

Altered globotriaosylceramide accumulation and mucosal neuronal fiber density in the colon of the Fabry disease mouse model

Masotti

Delprete

Dothel

et al. 2019

Neurogastroenterology Motil

Self Cite

View full text Add to dashboard Cite

Background Fabry disease (FD) is a hereditary X‐linked metabolic storage disorder characterized by deficient or absent lysosomal α‐galactosidase A (α‐Gal A) activity. This deficiency causes progressive accumulation of glycosphingolipids, primarily globotriaosylceramide (Gb3), in nearly all organ systems. Gastrointestinal (GI) symptoms can be very debilitating and are among the most frequent and earliest of the disease. As the pathophysiology of these symptoms is poorly understood, we carried out a morphological and molecular characterization of the GI tract in α‐Gal A knockout mice colon in order to reveal the underlying mechanisms. Methods Here, we performed the first morphological and biomolecular characterization of the colon wall structure in the GI tract of the α‐Gal A knock‐out mouse (α‐Gal A −/0), a murine model of FD. Key Results Our data show a greater thickness of the gastrointestinal wall in α‐Gal A (−/0) mice due to enlarged myenteric plexus' ganglia. This change is paralleled by a marked Gb3 accumulation in the gastrointestinal wall and a decreased and scattered pattern of mucosal nerve fibers. Conclusions and Inferences The observed alterations are likely to be a leading cause of gut motor dysfunctions experienced by FD patients and imply that the α‐Gal A (−/0) male mouse represents a reliable model for translational studies on enteropathic pain and GI symptoms in FD.

show abstract

Pain Related Channels Are Differentially Expressed in Neuronal and Non-Neuronal Cells of Glabrous Skin of Fabry Knockout Male Mice

Cited by 47 publications

References 70 publications

Changes in Ionic Conductance Signature of Nociceptive Neurons Underlying Fabry Disease Phenotype

Changes in Ionic Conductance Signature of Nociceptive Neurons Underlying Fabry Disease Phenotype

Chronic intestinal pseudo-obstruction. Did you search for lysosomal storage diseases?

Altered globotriaosylceramide accumulation and mucosal neuronal fiber density in the colon of the Fabry disease mouse model

Contact Info

Product

Resources

About