Paladin is an antiphosphatase that regulates neural crest cell formation and migration

Abstract

Although a network of transcription factors that specifies neural crest identity in the ectoderm has been defined, expression of neural crest transcription factors does not guarantee eventual migration as a neural crest cell. While much work has gone into determining regulatory relationships within the transcription factor network, the ability of protein modifications like phosphorylation to modulate the function of neural crest regulatory factors and determine when and where they are active also has crucial implications. Paladin, which was previously classified as a phosphatase based on sequence similarity, is expressed in chick neural crest precursors and is maintained throughout their epithelial to mesenchymal transition and migration. Loss of Paladin delays the expression of transcription factors Snail2 and Sox10 in premigratory neural crest cells, but does not affect accumulation of FoxD3, Cad6B or RhoB, indicating that Paladin differentially modulates the expression of genes previously thought to be coregulated within the neural crest gene regulatory network. Both gain and loss of Paladin function result in disrupted neural crest migration, reinforcing the importance of precisely regulated phosphorylation for neural crest migration. Mutation of critical, catalytic cysteine residues within Paladin’s predicted phosphatase active site motifs did not abolish the function of Paladin in the neural crest. Collectively, these data indicate that Paladin is an antiphosphatase that modulates the activity of specific neural crest regulatory factors during neural crest development. Our work identifies a novel regulator of phosphorylation status that provides an additional layer of regulation in the neural crest.

The extended human PTPome: a growing tyrosine phosphatase family

“…Similar data have been found in mouse embryos, where paladin has been detected, in addition to the notochord, in the roof and floor plates of the neural tube, along with rhombomeres 2 and 4, and pharyngeal arches 1 and 2 [81]. Mutation of the two Cys residues present in the phosphatase domains of paladin does not affect its function in chicken neural crest development, indicating the existence of paladin phosphatase-independent functions [80].…”

“…Paladin expression is regulated in neural crest induction . In this sense, paladin is found in chickens specifically expressed in premigratory and migratory neural crest cells, and is involved in early neural crest migration . Similar data have been found in mouse embryos, where paladin has been detected, in addition to the notochord, in the roof and floor plates of the neural tube, along with rhombomeres 2 and 4, and pharyngeal arches 1 and 2 .…”

Neural crest specification and migration independently require NSD3-related lysine methyltransferase activity

“…To address the possibility that NSD3Δ1707 elicits a methyltransferase-independent overexpression phenotype rather than a dominant-negative effect, we created a full-length NSD3 expression construct traced by bicistronic expression of mCherry (pMESmCh-NSD3; Roffers-Agarwal et al. , 2012 ).…”

“…Morpholino antisense oligonucleotides (MOs) 3′ modified with fluorescein (FITC) were obtained from GeneTools (Philomath, OR) with the following sequences: NSD3 splice acceptor MO (NSD3 MO1), TGCACCTGGAGAGAACAACACAAGC; 5–base pair mismatch control NSD3 splice acceptor MO (NSD3 mmMO1), TGCAC G T C GAGA C AACAACA G AA C C (mismatches underlined); NSD3 splice donor MO (NSD3 MO2), TGGTGACCTTCCTCCCTTACCTCTT; and NSD3 translation-blocking MO (NSD3 trans MO), AACCAGCAGCATCCCCAAGGTCCAT. The full-length NSD3 overexpression construct was PCR amplified from chick 6- to 10-somite cDNA and cloned into pMES-mCherry ( Roffers-Agarwal et al. , 2012 ).…”

Expression of actin‐binding proteins and requirement for actin‐depolymerizing factor in chick neural crest cells

“…Ex ovo early embryo electroporation was performed on late gastrula stage 4-5 embryos with ADF or CO MO at 1.0 mM as previously described (Gammill and Krull, 2011;Roffers-Agarwal et al, 2012).…”